Reactome PowerPoint PPT Presentations

All Time
Show:
Recommended
Sort by:
Instructions for Arabidopsis Reactome Authors PowerPoint PPT Presentation
Instructions for Arabidopsis Reactome Authors - Optional - Input your pathway using Author Tool (8-10) ... Make a list of references (7) used as experimental evidence for reactions and pathways. ...
Optional - Input your pathway using Author Tool (8-10) ... Make a list of references (7) used as experimental evidence for reactions and pathways. ...
| PowerPoint PPT presentation | free to view
Reactome a pathways knowledgebase PowerPoint PPT Presentation
Reactome a pathways knowledgebase - Insulin binds the insulin receptor, causing it to ... Started as Genome Knowledgebase in ... Rules for orthology-based inference. 75% of a complex must have ...
Insulin binds the insulin receptor, causing it to ... Started as Genome Knowledgebase in ... Rules for orthology-based inference. 75% of a complex must have ...
| PowerPoint PPT presentation | free to download
Agenda PowerPoint PPT Presentation
Agenda - Agenda Biological databases related to microarray Gene Ontology KEGG Biocarta Reactome MSigDB Pathway enrichment analysis GSEA GSA Ingenuity Pathway Analysis (IPA)
Agenda Biological databases related to microarray Gene Ontology KEGG Biocarta Reactome MSigDB Pathway enrichment analysis GSEA GSA Ingenuity Pathway Analysis (IPA)
| PowerPoint PPT presentation | free to download
Source Bohringer-Mannheim PowerPoint PPT Presentation
Source Bohringer-Mannheim - ... The Reactome 3.15 pm Hector Keun:Metabonomics and modeling metabolic networks. 3.45-4.15pm maxi-BREAK 4.15 pm Philip Bang: Machine Learning for Systems Biology 4 ...
... The Reactome 3.15 pm Hector Keun:Metabonomics and modeling metabolic networks. 3.45-4.15pm maxi-BREAK 4.15 pm Philip Bang: Machine Learning for Systems Biology 4 ...
| PowerPoint PPT presentation | free to download
Lisa Matthews,1 Esther Schmidt,2 Suzanna Lewis,3 David Croft, 2 Bernard de Bono, 2 Peter D'Eustachio PowerPoint PPT Presentation
Lisa Matthews,1 Esther Schmidt,2 Suzanna Lewis,3 David Croft, 2 Bernard de Bono, 2 Peter D'Eustachio - To boost the volume of Reactome annotations submitted to GOA, we will: ... Reactome:GOA collaboration. Current ... hierarchies to show selected term from one ...
To boost the volume of Reactome annotations submitted to GOA, we will: ... Reactome:GOA collaboration. Current ... hierarchies to show selected term from one ...
| PowerPoint PPT presentation | free to download
Introduction to PDB Workshop From Molecules to Medicine: Integrating Crystallography in Drug Discove PowerPoint PPT Presentation
Introduction to PDB Workshop From Molecules to Medicine: Integrating Crystallography in Drug Discove - To provide a global resource for the advancement of ... SCOP/CATH. BioCyc. Pfam. Reactome. Enzyme Classification. PubMed. GeneRIF. IHOP. Abstract search ...
To provide a global resource for the advancement of ... SCOP/CATH. BioCyc. Pfam. Reactome. Enzyme Classification. PubMed. GeneRIF. IHOP. Abstract search ...
| PowerPoint PPT presentation | free to view
Lecture Outline PowerPoint PPT Presentation
Lecture Outline - ... or biological labels (human, mouse, Drosophila, yeast, worm and UniProt proteins) ... http://www.reactome.org/cgi-bin/skypainter2. SkyPainter ...
... or biological labels (human, mouse, Drosophila, yeast, worm and UniProt proteins) ... http://www.reactome.org/cgi-bin/skypainter2. SkyPainter ...
| PowerPoint PPT presentation | free to view
Lisa Matthews,1 Esther Schmidt,2 Suzanna Lewis,3 David Croft, 2 Bernard de Bono, 2 Peter D'Eustachio PowerPoint PPT Presentation
Lisa Matthews,1 Esther Schmidt,2 Suzanna Lewis,3 David Croft, 2 Bernard de Bono, 2 Peter D'Eustachio - Reactome is a curated, refereed resource of human biological processes that can ... alphabetically or in tree format. Synchronizing selection aligns Reactome and GO ...
Reactome is a curated, refereed resource of human biological processes that can ... alphabetically or in tree format. Synchronizing selection aligns Reactome and GO ...
| PowerPoint PPT presentation | free to download
Learning and exploring Life science through the EBI reosurces and tools PowerPoint PPT Presentation
Learning and exploring Life science through the EBI reosurces and tools - Learning and exploring Life science through the EBI reosurces and tools BIOQUEST workshop_2011 Vicky Schneider, EMBL-EBI Training Programme Project leader
Learning and exploring Life science through the EBI reosurces and tools BIOQUEST workshop_2011 Vicky Schneider, EMBL-EBI Training Programme Project leader
| PowerPoint PPT presentation | free to view
Metodi post-genomici PowerPoint PPT Presentation
Metodi post-genomici - Title: Tecniche post-genomiche Author: dino Last modified by: mfasano Created Date: 3/13/2005 8:49:18 PM Document presentation format: Presentazione su schermo (4:3)
Title: Tecniche post-genomiche Author: dino Last modified by: mfasano Created Date: 3/13/2005 8:49:18 PM Document presentation format: Presentazione su schermo (4:3)
| PowerPoint PPT presentation | free to view
Gene Set Enrichment and Pathways Analysis PowerPoint PPT Presentation
Gene Set Enrichment and Pathways Analysis - Boehringer Mannheim Wall Charts. Metabolic Pathways. Cellular and Molecular ... Carbohydrate, Energy, Lipid, Nucleotide, Amino acid, Other amino acid, Glycan, ...
Boehringer Mannheim Wall Charts. Metabolic Pathways. Cellular and Molecular ... Carbohydrate, Energy, Lipid, Nucleotide, Amino acid, Other amino acid, Glycan, ...
| PowerPoint PPT presentation | free to view
BiNoM Tutorial PowerPoint PPT Presentation
BiNoM Tutorial - Andrei Zinovyev, Laurence Calzone. UMR U900 INSERM/Institut Curie/Ecole des Mines de Paris ... BiNoM is a plugin for Cytoscape. http://cytoscape.org/ Install ...
Andrei Zinovyev, Laurence Calzone. UMR U900 INSERM/Institut Curie/Ecole des Mines de Paris ... BiNoM is a plugin for Cytoscape. http://cytoscape.org/ Install ...
| PowerPoint PPT presentation | free to download
Bio-Trac 25 (Proteomics: Principles and Methods) PowerPoint PPT Presentation
Bio-Trac 25 (Proteomics: Principles and Methods) - Title: Protein Family Classification for Functional Genomics Author: wuc Last modified by: zh9 Created Date: 3/9/2001 10:06:29 PM Document presentation format
Title: Protein Family Classification for Functional Genomics Author: wuc Last modified by: zh9 Created Date: 3/9/2001 10:06:29 PM Document presentation format
| PowerPoint PPT presentation | free to view
Protein Pathways and Pathway Databases PowerPoint PPT Presentation
Protein Pathways and Pathway Databases - All pathways are networks of interactions, however not all networks are ... Chemical substructure comparison. Enzymes,Transcription Factors. Genes: Blast search ...
All pathways are networks of interactions, however not all networks are ... Chemical substructure comparison. Enzymes,Transcription Factors. Genes: Blast search ...
| PowerPoint PPT presentation | free to view
Biological Pathways PowerPoint PPT Presentation
Biological Pathways - Biological Pathways ... PPI databases Many databases DIP Established in 1999 in UCLA extract and integrate protein-protein info and build a user-friendly ...
Biological Pathways ... PPI databases Many databases DIP Established in 1999 in UCLA extract and integrate protein-protein info and build a user-friendly ...
| PowerPoint PPT presentation | free to download
012 Pre-prepare KEGG mapping PowerPoint PPT Presentation
012 Pre-prepare KEGG mapping - 020 Take slice. 025 Primary content checks: -Is everything intended included? ... Fix web site/code. 013 -Update ... Fix web code. nnn - identifier for a step. ...
020 Take slice. 025 Primary content checks: -Is everything intended included? ... Fix web site/code. 013 -Update ... Fix web code. nnn - identifier for a step. ...
| PowerPoint PPT presentation | free to download
Red Bioinform PowerPoint PPT Presentation
Red Bioinform - Red Bioinform tica para la predicci n de la funci n molecular La investigaci n en biolog a produce grandes cantidades de informaci n disponible.
Red Bioinform tica para la predicci n de la funci n molecular La investigaci n en biolog a produce grandes cantidades de informaci n disponible.
| PowerPoint PPT presentation | free to download
Community Standards and Comparative Genomics PowerPoint PPT Presentation
Community Standards and Comparative Genomics - Community Standards and Comparative Genomics
Community Standards and Comparative Genomics
| PowerPoint PPT presentation | free to view
Making Sense Out of Transcriptome Integrative Bioinformatic Approaches PowerPoint PPT Presentation
Making Sense Out of Transcriptome Integrative Bioinformatic Approaches - Making Sense Out of Transcriptome Integrative Bioinformatic Approaches
Making Sense Out of Transcriptome Integrative Bioinformatic Approaches
| PowerPoint PPT presentation | free to view
Bioe131: Introduction to Computational Biology PowerPoint PPT Presentation
Bioe131: Introduction to Computational Biology - (Some ribosomes are free-floating in the cytosol) ... Usually found as a 'zwitterion' RNA structure. Biological Databases. Chemical structures ' ...
(Some ribosomes are free-floating in the cytosol) ... Usually found as a 'zwitterion' RNA structure. Biological Databases. Chemical structures ' ...
| PowerPoint PPT presentation | free to view
Canadian Bioinformatics Workshops PowerPoint PPT Presentation
Canadian Bioinformatics Workshops - Canadian Bioinformatics Workshops www.bioinformatics.ca
Canadian Bioinformatics Workshops www.bioinformatics.ca
| PowerPoint PPT presentation | free to view
Kei Cheung, Ph.D. PowerPoint PPT Presentation
Kei Cheung, Ph.D. - BioRDF Task Overview and Update Kei Cheung, Ph.D. Yale Center for Medical Informatics Matthias Samwald, Ph.D. Digital Enterprise Research Institute, Galway, Ireland
BioRDF Task Overview and Update Kei Cheung, Ph.D. Yale Center for Medical Informatics Matthias Samwald, Ph.D. Digital Enterprise Research Institute, Galway, Ireland
| PowerPoint PPT presentation | free to download
Biopath (BMOND) PowerPoint PPT Presentation
Biopath (BMOND) - BioUML integrated platform for building virtual cell and virtual physiological human Fedor Kolpakov1,2, Nikita Tolstykh1,2, Elena Kutumova1,2, Ilya Kiselev1,2,
BioUML integrated platform for building virtual cell and virtual physiological human Fedor Kolpakov1,2, Nikita Tolstykh1,2, Elena Kutumova1,2, Ilya Kiselev1,2,
| PowerPoint PPT presentation | free to download
Using%20Biomedical%20Literature%20Mining%20to%20Consolidate%20the%20Set%20of%20Known%20Human%20Protein-Protein%20Interactions PowerPoint PPT Presentation
Using%20Biomedical%20Literature%20Mining%20to%20Consolidate%20the%20Set%20of%20Known%20Human%20Protein-Protein%20Interactions - A binary flag set on true if the word is part of a protein dictionary. ... Intelligence in Medicine (Special Issue on Summarization and Information ...
A binary flag set on true if the word is part of a protein dictionary. ... Intelligence in Medicine (Special Issue on Summarization and Information ...
| PowerPoint PPT presentation | free to download
Pathway Analysis PowerPoint PPT Presentation
Pathway Analysis - Pathway Analysis Martina Kutmon ... Software will take care of it e.g. PathVisio uses synonym databases You will have to convert the ids yourself DAVID: ...
Pathway Analysis Martina Kutmon ... Software will take care of it e.g. PathVisio uses synonym databases You will have to convert the ids yourself DAVID: ...
| PowerPoint PPT presentation | free to view
Resources for Teaching Systems Biology PowerPoint PPT Presentation
Resources for Teaching Systems Biology - Biologists have been studying and modeling systems for decades (i.e. physiology) Current systems biology craze has resulted from recent technologies that allow ...
Biologists have been studying and modeling systems for decades (i.e. physiology) Current systems biology craze has resulted from recent technologies that allow ...
| PowerPoint PPT presentation | free to view
An RNA Interference Strategy for Identifying Host Factors Required for HIV Infection PowerPoint PPT Presentation
An RNA Interference Strategy for Identifying Host Factors Required for HIV Infection - An RNA Interference Strategy for Identifying Host Factors Required for ... Caroline Shamu and staff, ICCB-L HMS. Felipe Diaz-Griffero, DFCI, HMS. Harvard CFAR ...
An RNA Interference Strategy for Identifying Host Factors Required for ... Caroline Shamu and staff, ICCB-L HMS. Felipe Diaz-Griffero, DFCI, HMS. Harvard CFAR ...
| PowerPoint PPT presentation | free to view
Medical Informatics PowerPoint PPT Presentation
Medical Informatics - ... Unified Medical Language System (UMLS) Gene World Biomedical World Molecular Function = elemental activity/task the tasks performed by individual gene products; ...
... Unified Medical Language System (UMLS) Gene World Biomedical World Molecular Function = elemental activity/task the tasks performed by individual gene products; ...
| PowerPoint PPT presentation | free to download
SPIKE PowerPoint PPT Presentation
SPIKE - Yossi Shiloh. Database for regulatory interactions. Visualization module. Constructs graphical pathway maps based on the information stored in the database ...
Yossi Shiloh. Database for regulatory interactions. Visualization module. Constructs graphical pathway maps based on the information stored in the database ...
| PowerPoint PPT presentation | free to view
DIAMONDS project PowerPoint PPT Presentation
DIAMONDS project - Text mining (iHOP) GIN-sim. SIMplex. WORKPACKAGE 5. ... Text mining (iHOP) GIN-sim. SIMplex ... iHOP web service from CSIC. WORKPACKAGE 5. Cell Cycle Portal ...
Text mining (iHOP) GIN-sim. SIMplex. WORKPACKAGE 5. ... Text mining (iHOP) GIN-sim. SIMplex ... iHOP web service from CSIC. WORKPACKAGE 5. Cell Cycle Portal ...
| PowerPoint PPT presentation | free to view
gcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgactta PowerPoint PPT Presentation
gcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgactta - Title: 1 Author: Rahmaninova Last modified by: ravcheyev Created Date: 2/9/2006 1:13:17 PM Document presentation format: On-screen Show Company
Title: 1 Author: Rahmaninova Last modified by: ravcheyev Created Date: 2/9/2006 1:13:17 PM Document presentation format: On-screen Show Company
| PowerPoint PPT presentation | free to download
Medical Informatics PowerPoint PPT Presentation
Medical Informatics - BMC Bioinformatics 8(1): 392 [Epub ahead of print] Applications: For functional enrichment For candidate gene prioritization Why another gene prioritization method?
BMC Bioinformatics 8(1): 392 [Epub ahead of print] Applications: For functional enrichment For candidate gene prioritization Why another gene prioritization method?
| PowerPoint PPT presentation | free to download
Database mining with biomaRt PowerPoint PPT Presentation
Database mining with biomaRt - Database mining with biomaRt Steffen Durinck Illumina Inc. Overview The BioMart software suite biomaRt package biomaRt installation biomaRt example queries to show ...
Database mining with biomaRt Steffen Durinck Illumina Inc. Overview The BioMart software suite biomaRt package biomaRt installation biomaRt example queries to show ...
| PowerPoint PPT presentation | free to download
Orthologs, Diseases, and Interactions PowerPoint PPT Presentation
Orthologs, Diseases, and Interactions - Orthology Report. List of diseases for gene. Searching Multiple Ontologies ... Orthology and Disease. Search functionalities. Interlinking between pages ...
Orthology Report. List of diseases for gene. Searching Multiple Ontologies ... Orthology and Disease. Search functionalities. Interlinking between pages ...
| PowerPoint PPT presentation | free to download
BioUML PowerPoint PPT Presentation
BioUML - BioUML integrated platform for systems biology: From gene regulatory networks to modeling virtual cell and virtual physiological human Fedor Kolpakov
BioUML integrated platform for systems biology: From gene regulatory networks to modeling virtual cell and virtual physiological human Fedor Kolpakov
| PowerPoint PPT presentation | free to download
BioPAX Biological Pathway Data Exchange Format PowerPoint PPT Presentation
BioPAX Biological Pathway Data Exchange Format - Arguably the most accessible data source, but... Varied formats, representation, coverage ... 7pm - Dinner at Trellis Italian restaurant. Agenda - Day 2 ...
Arguably the most accessible data source, but... Varied formats, representation, coverage ... 7pm - Dinner at Trellis Italian restaurant. Agenda - Day 2 ...
| PowerPoint PPT presentation | free to view
BioTrac 25 Proteomics: Principles and Methods PowerPoint PPT Presentation
BioTrac 25 Proteomics: Principles and Methods - BioTrac 25 Proteomics: Principles and Methods
BioTrac 25 Proteomics: Principles and Methods
| PowerPoint PPT presentation | free to view
GO based data analysis PowerPoint PPT Presentation
GO based data analysis - All tools and materials from this workshop are available online at the AgBase ... Rosetta stone method. Text mining. TAP assays. Yeast two hybrid (Y2H) Protein arrays ...
All tools and materials from this workshop are available online at the AgBase ... Rosetta stone method. Text mining. TAP assays. Yeast two hybrid (Y2H) Protein arrays ...
| PowerPoint PPT presentation | free to view
Pathways and Molecules: Noodles and Meatballs in the Metabolite Soup PowerPoint PPT Presentation
Pathways and Molecules: Noodles and Meatballs in the Metabolite Soup - EMP enzymology and metabolism data. MetaCyc metabolic pathways. EcoCyc E. coli genome and metabolism. PathDB biological pathways and networks ...
EMP enzymology and metabolism data. MetaCyc metabolic pathways. EcoCyc E. coli genome and metabolism. PathDB biological pathways and networks ...
| PowerPoint PPT presentation | free to view
Bioinformatics is specific Computational Biology PowerPoint PPT Presentation
Bioinformatics is specific Computational Biology
| PowerPoint PPT presentation | free to view
Bio-Trac 25 (Proteomics: Principles and Methods) PowerPoint PPT Presentation
Bio-Trac 25 (Proteomics: Principles and Methods) - Proteomic Resources 2D-Gel Image Databases Slide 49 PRIDE: centralized, standards compliant, public data repository for proteomics data Slide 51 ...
Proteomic Resources 2D-Gel Image Databases Slide 49 PRIDE: centralized, standards compliant, public data repository for proteomics data Slide 51 ...
| PowerPoint PPT presentation | free to download
Pathways PowerPoint PPT Presentation
Pathways - M.A. Ott (CMBI) Pathways & Molecules Contents Enzymes and Metabolites Metabolic Pathways: Cholesterol Biosynthesis Metabolic Disorders BioMeta Database ...
M.A. Ott (CMBI) Pathways & Molecules Contents Enzymes and Metabolites Metabolic Pathways: Cholesterol Biosynthesis Metabolic Disorders BioMeta Database ...
| PowerPoint PPT presentation | free to view
Towards a Complete Covering of SBML Functionalities PowerPoint PPT Presentation
Towards a Complete Covering of SBML Functionalities - kosmopolit s, has been used to describe a wide variety of important views in ... stoichiometry='1.0'/ /listOfReactants kineticLaw ...
kosmopolit s, has been used to describe a wide variety of important views in ... stoichiometry='1.0'/ /listOfReactants kineticLaw ...
| PowerPoint PPT presentation | free to download
About OMICS Group PowerPoint PPT Presentation
About OMICS Group - About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events.
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events.
| PowerPoint PPT presentation | free to download
The Cancer Biomedical Informatics Grid PowerPoint PPT Presentation
The Cancer Biomedical Informatics Grid - The Cancer Biomedical Informatics Grid (caBIG ): Overview of the Integrative Cancer Research Workspace ... U Iowa Translational Tools Tom Moloshok, ...
The Cancer Biomedical Informatics Grid (caBIG ): Overview of the Integrative Cancer Research Workspace ... U Iowa Translational Tools Tom Moloshok, ...
| PowerPoint PPT presentation | free to view
Genetic Literature Curation at FlyBaseCambridge PowerPoint PPT Presentation
Genetic Literature Curation at FlyBaseCambridge - Semi-automated search of publication databases. Medline, BIOSIS, ZooRec ... Curate material into individual proformae' to form a curation record' Error-checking: ...
Semi-automated search of publication databases. Medline, BIOSIS, ZooRec ... Curate material into individual proformae' to form a curation record' Error-checking: ...
| PowerPoint PPT presentation | free to view
Database mining with biomaRt PowerPoint PPT Presentation
Database mining with biomaRt - Database mining with biomaRt Steffen Durinck Illumina Inc. Overview The BioMart software suite biomaRt package biomaRt installation biomaRt example queries to show ...
Database mining with biomaRt Steffen Durinck Illumina Inc. Overview The BioMart software suite biomaRt package biomaRt installation biomaRt example queries to show ...
| PowerPoint PPT presentation | free to download
Creating the right chemistry in Pathways PowerPoint PPT Presentation
Creating the right chemistry in Pathways - Systems biology ...not in ten years. Pathways which? ... Tautomerism (variable positions of hydrogens) Other 'chemical' flexibility. Protonation state ...
Systems biology ...not in ten years. Pathways which? ... Tautomerism (variable positions of hydrogens) Other 'chemical' flexibility. Protonation state ...
| PowerPoint PPT presentation | free to view
BRCA1 Maintains Genomic Integrity by Regulating DNA Repair via Double Strand Break Repair Methods in PowerPoint PPT Presentation
BRCA1 Maintains Genomic Integrity by Regulating DNA Repair via Double Strand Break Repair Methods in - BRCA1 Maintains Genomic Integrity by Regulating DNA Repair via Double Strand ... ATM (ataxia telangiectasia mutated) is a protein is involved in detecting DNA ...
BRCA1 Maintains Genomic Integrity by Regulating DNA Repair via Double Strand ... ATM (ataxia telangiectasia mutated) is a protein is involved in detecting DNA ...
| PowerPoint PPT presentation | free to view
Guest Lecture PowerPoint PPT Presentation
Guest Lecture - Database concepts - what is a 'good' database (DB) How is data stored and ... has open interfaces (APIs) for query requests. Bad DB: ... APIs, Mashups, SQL ...
Database concepts - what is a 'good' database (DB) How is data stored and ... has open interfaces (APIs) for query requests. Bad DB: ... APIs, Mashups, SQL ...
| PowerPoint PPT presentation | free to view
Biopath (BMOND) PowerPoint PPT Presentation
Biopath (BMOND) - BioUML integrated platform for building virtual cell and virtual physiological human Fedor Kolpakov1,2, Nikita Tolstykh1,2, Elena Kutumova1,2, Ilya Kiselev1,2,
BioUML integrated platform for building virtual cell and virtual physiological human Fedor Kolpakov1,2, Nikita Tolstykh1,2, Elena Kutumova1,2, Ilya Kiselev1,2,
| PowerPoint PPT presentation | free to download
ChEBI: The story so far PowerPoint PPT Presentation
ChEBI: The story so far - Bioinformatics data too large to keep track of chemical compounds ... H l ne Courrier, Stephane Nauche, Jeremy Parsons. Database supporters ...
Bioinformatics data too large to keep track of chemical compounds ... H l ne Courrier, Stephane Nauche, Jeremy Parsons. Database supporters ...
| PowerPoint PPT presentation | free to view
Combining Computational Prediction and Manual Curation to Create Plant Metabolic Pathway Databases PowerPoint PPT Presentation
Combining Computational Prediction and Manual Curation to Create Plant Metabolic Pathway Databases - Combining Computational Prediction and Manual Curation to Create Plant Metabolic Pathway Databases Peifen Zhang Carnegie Institution For Science
Combining Computational Prediction and Manual Curation to Create Plant Metabolic Pathway Databases Peifen Zhang Carnegie Institution For Science
| PowerPoint PPT presentation | free to download
EBI as a research infrastructure PowerPoint PPT Presentation
EBI as a research infrastructure - ... of Bioinformatics, Geneva, ... Stockholm Bioinformatics Centre, Sweden ... The European Bioinformatics Institute / The European Molecular Biology ...
... of Bioinformatics, Geneva, ... Stockholm Bioinformatics Centre, Sweden ... The European Bioinformatics Institute / The European Molecular Biology ...
| PowerPoint PPT presentation | free to download
Harnessing the Semantic Web to Answer Scientific Questions: PowerPoint PPT Presentation
Harnessing the Semantic Web to Answer Scientific Questions: - Harnessing the Semantic Web to Answer Scientific Questions: A Health Care and Life Sciences Interest Group demo Susie Stephens, Principal Research Scientist, Lilly
Harnessing the Semantic Web to Answer Scientific Questions: A Health Care and Life Sciences Interest Group demo Susie Stephens, Principal Research Scientist, Lilly
| PowerPoint PPT presentation | free to download


Home About Us Terms and Conditions Privacy Policy Contact Us
Copyright 2024 CrystalGraphics, Inc. — All rights Reserved. PowerShow.com is a trademark of CrystalGraphics, Inc.
reactome — Search results on PowerShow.com