3,016 Substrings PPTs View free & download

Linear Time Suffix Array Construction Using DCritical Substrings PowerPoint PPT Presentation

Linear Time Suffix Array Construction Using DCritical Substrings - 1. Linear Time Suffix Array Construction Using D-Critical Substrings. Ge Nong, Sun Yat-sen Univ. ... and lexicographically smallest sentinel $ at the end, the ...

1. Linear Time Suffix Array Construction Using D-Critical Substrings. Ge Nong, Sun Yat-sen Univ. ... and lexicographically smallest sentinel $ at the end, the ...

| PowerPoint PPT presentation | free to view

Applications PowerPoint PPT Presentation

Applications - Longest common substrings. Finding and representing repeated substrings efficiently ... Let Li be the list of leaves with identifier i, in increasing order of ...

Longest common substrings. Finding and representing repeated substrings efficiently ... Let Li be the list of leaves with identifier i, in increasing order of ...

| PowerPoint PPT presentation | free to download

MEME: Multiple Expectation Maximization for Motif Elicitation PowerPoint PPT Presentation

MEME: Multiple Expectation Maximization for Motif Elicitation - ... set of strings, find a set of non-overlapping approximately matching substrings. Approximately matching substrings must all have the same length ...

... set of strings, find a set of non-overlapping approximately matching substrings. Approximately matching substrings must all have the same length ...

| PowerPoint PPT presentation | free to view

An Efficient Index Structure for String Databases PowerPoint PPT Presentation

An Efficient Index Structure for String Databases - Find similar substrings in a database, that are similar to a given query string ... Extend to weighted edit distance and affine gaps. ...

Find similar substrings in a database, that are similar to a given query string ... Extend to weighted edit distance and affine gaps. ...

| PowerPoint PPT presentation | free to download

Extracting Key-Substring-Group Features for Text Classification PowerPoint PPT Presentation

Extracting Key-Substring-Group Features for Text Classification - Throw out groups that are not statistically significant Approach Use a generalized suffix-tree to capture all substrings of a corpus.

Throw out groups that are not statistically significant Approach Use a generalized suffix-tree to capture all substrings of a corpus.

| PowerPoint PPT presentation | free to download

Boyer Moore Searches on Binary Texts PowerPoint PPT Presentation

Boyer Moore Searches on Binary Texts - Boyer Moore Searches. on Binary Texts. Shmuel Tomi Klein ... World Factbook (1.5MB) Text: Huffman encoded. Patterns: Random substrings. of lengths 10 to 500 ...

Boyer Moore Searches. on Binary Texts. Shmuel Tomi Klein ... World Factbook (1.5MB) Text: Huffman encoded. Patterns: Random substrings. of lengths 10 to 500 ...

| PowerPoint PPT presentation | free to download

Splicing Exons: A Eukaryotic Challenge to Gene Prediction PowerPoint PPT Presentation

Splicing Exons: A Eukaryotic Challenge to Gene Prediction - All substrings that exhibit a certain level of similarity will be called putative exons. ... Use brute force to generate a set of putative exons. ...

All substrings that exhibit a certain level of similarity will be called putative exons. ... Use brute force to generate a set of putative exons. ...

| PowerPoint PPT presentation | free to download

An Efficient Index Structure for String Databases - Find similar substrings in a large database, that is similar to a given query ... searching keywords through the net: usually by 'mtallica' we mean 'metallica' ...

Find similar substrings in a large database, that is similar to a given query ... searching keywords through the net: usually by 'mtallica' we mean 'metallica' ...

| PowerPoint PPT presentation | free to view

Fragment Assembly PowerPoint PPT Presentation

Fragment Assembly - Fragments are typically of 200-700 bp long 'Target' string is about 30k 100k bp long ... Think of an algorithm for weeding out substrings from F ...

Fragments are typically of 200-700 bp long 'Target' string is about 30k 100k bp long ... Think of an algorithm for weeding out substrings from F ...

| PowerPoint PPT presentation | free to view

Cube - 3 by 3 by 3 cube built of 27 smaller cubes ... Substrings representing the front, middle and back plane. Substrings representing the top, middle and bottom row ...

3 by 3 by 3 cube built of 27 smaller cubes ... Substrings representing the front, middle and back plane. Substrings representing the top, middle and bottom row ...

| PowerPoint PPT presentation | free to download

A Unified Algorithm for Accelerating EditDistance Computation via TextCompression PowerPoint PPT Presentation

A Unified Algorithm for Accelerating EditDistance Computation via TextCompression - A Unified Algorithm for Accelerating Edit-Distance Computation ... Masek, Paterson '80 ... Short enough substrings must appear many times (Masek and Paterson) ...

A Unified Algorithm for Accelerating Edit-Distance Computation ... Masek, Paterson '80 ... Short enough substrings must appear many times (Masek and Paterson) ...

| PowerPoint PPT presentation | free to view

JavaScript, Fourth Edition PowerPoint PPT Presentation

JavaScript, Fourth Edition - Finding and Extracting Characters and Substrings. JavaScript, Fourth Edition. 9 ... it searches for the ampersand in the e-mail addresses using a regular expression ...

Finding and Extracting Characters and Substrings. JavaScript, Fourth Edition. 9 ... it searches for the ampersand in the e-mail addresses using a regular expression ...

| PowerPoint PPT presentation | free to view

Pattern Matching: Suffix Tree Applications PowerPoint PPT Presentation

Pattern Matching: Suffix Tree Applications - Exact string and substring matching. Longest common substrings ... String a labeling the path to an internal node v of T is a maximal repeat if and ...

Exact string and substring matching. Longest common substrings ... String a labeling the path to an internal node v of T is a maximal repeat if and ...

| PowerPoint PPT presentation | free to view

CISC 667 Intro to Bioinformatics (Fall 2005) Pairwise sequence alignment PowerPoint PPT Presentation

CISC 667 Intro to Bioinformatics (Fall 2005) Pairwise sequence alignment - why need local alignment (vs global)? mosaic structure ( functioning domains) of proteins, which ... there are T(n2 m2) pairs of substrings; to align each pair ...

why need local alignment (vs global)? mosaic structure ( functioning domains) of proteins, which ... there are T(n2 m2) pairs of substrings; to align each pair ...

| PowerPoint PPT presentation | free to download

Bioinformatics Algorithms and Data Structures PowerPoint PPT Presentation

Bioinformatics Algorithms and Data Structures - As the text mentions: the weights are usually derived from the PAM matrices of ... Computing End-Space Free Alignment for every pair of substrings. ...

As the text mentions: the weights are usually derived from the PAM matrices of ... Computing End-Space Free Alignment for every pair of substrings. ...

| PowerPoint PPT presentation | free to download

String Manipulation PowerPoint PPT Presentation

String Manipulation - Splits a string into an array of substrings based on the location and ... The split() Method ... 'apple, banana, peach, orange' What about 'apple, 0.99, banana, 0.50, peach, ...

Splits a string into an array of substrings based on the location and ... The split() Method ... 'apple, banana, peach, orange' What about 'apple, 0.99, banana, 0.50, peach, ...

| PowerPoint PPT presentation | free to view

- Everything Else Find all substrings We ve learned how to find the first location of a string in another string with find. What about finding all matches?

Everything Else Find all substrings We ve learned how to find the first location of a string in another string with find. What about finding all matches?

| PowerPoint PPT presentation | free to download

PiecewiseLinear Gap Formula Alignment in Linear Space PowerPoint PPT Presentation

PiecewiseLinear Gap Formula Alignment in Linear Space - Given two strings X and Y for lengths m and n, we wish to find the longest ... Waterman) alignment of substrings, not a global (Needleman-Wunsch) alignment of ...

Given two strings X and Y for lengths m and n, we wish to find the longest ... Waterman) alignment of substrings, not a global (Needleman-Wunsch) alignment of ...

| PowerPoint PPT presentation | free to view

l length of the substring. that we move. p2 position ... PowerPoint PPT Presentation

l length of the substring. that we move. p2 position ... - l - length of the substring. that we move. p2- position ... Si and Ti have two common substrings of length /Ai/ - Ai, and substring Xi, ... (n =length of S) ...

l - length of the substring. that we move. p2- position ... Si and Ti have two common substrings of length /Ai/ - Ai, and substring Xi, ... (n =length of S) ...

| PowerPoint PPT presentation | free to view

CS 430 INFO 430 Information Retrieval PowerPoint PPT Presentation

CS 430 INFO 430 Information Retrieval - 'feathered dinosaur' and (yixian or jehol) ... Simple algorithm: Build an inverted index of all substrings of the file names of the form *f, ...

'feathered dinosaur' and (yixian or jehol) ... Simple algorithm: Build an inverted index of all substrings of the file names of the form *f, ...

| PowerPoint PPT presentation | free to download

Fasta, Blast, Probabilities PowerPoint PPT Presentation

Fasta, Blast, Probabilities - ... T with substrings of s in a gapless alignment (k = 4 for proteins, 11 for DNA) ... in the text book). Considered state of the art nowadays. 50. BLOSUM 62 ...

... T with substrings of s in a gapless alignment (k = 4 for proteins, 11 for DNA) ... in the text book). Considered state of the art nowadays. 50. BLOSUM 62 ...

| PowerPoint PPT presentation | free to view

Regular expressions (contd.) -- remembering subpattern matches PowerPoint PPT Presentation

Regular expressions (contd.) -- remembering subpattern matches - Sub-patterns whose matching substrings are to be remembered are ... myString is now Fred is a cowgirl. Tom is a boy. Look-behind checks (contd.) (? !regexp) ...

Sub-patterns whose matching substrings are to be remembered are ... myString is now Fred is a cowgirl. Tom is a boy. Look-behind checks (contd.) (? !regexp) ...

| PowerPoint PPT presentation | free to view

Tsvi Kopelowitz PowerPoint PPT Presentation

Tsvi Kopelowitz - Compressing Substrings in Compressed Time. 2. Overview. Problem Definition. Motivation ... Context Substring Compression Query. Input: String S (to be preprocessed) ...

Compressing Substrings in Compressed Time. 2. Overview. Problem Definition. Motivation ... Context Substring Compression Query. Input: String S (to be preprocessed) ...

| PowerPoint PPT presentation | free to view

SPIRE2005 - Smith-Waterman the highest scoring alignment between any pair of substrings of ... The weakness of Smith Waterman approach [AP 2001] ...

Smith-Waterman the highest scoring alignment between any pair of substrings of ... The weakness of Smith Waterman approach [AP 2001] ...

| PowerPoint PPT presentation | free to download

SPIRE2005 - In our case, we look for the substrings (with their arcs) ... Local edit distance O(nm) [Smith Waterman 1981] Normalized LCS O(mnlogn) [Arslan Pevzner 2001] ...

In our case, we look for the substrings (with their arcs) ... Local edit distance O(nm) [Smith Waterman 1981] Normalized LCS O(mnlogn) [Arslan Pevzner 2001] ...

| PowerPoint PPT presentation | free to download

Mayssam Sayyadian PowerPoint PPT Presentation

Mayssam Sayyadian - Data integration techniques help data mining techniques ... of common substrings (Clinton St. vs. Bill Clinton, George West vs. West Main St., etc. ...

Data integration techniques help data mining techniques ... of common substrings (Clinton St. vs. Bill Clinton, George West vs. West Main St., etc. ...

| PowerPoint PPT presentation | free to download

Comparative%20genomics%20to%20identify%20DNA%20binding%20motifs PowerPoint PPT Presentation

Comparative%20genomics%20to%20identify%20DNA%20binding%20motifs - Comparative genomics to identify DNA binding motifs Saurabh Sinha Dept. of Computer Science University of Illinois, Urbana-Champaign

Comparative genomics to identify DNA binding motifs Saurabh Sinha Dept. of Computer Science University of Illinois, Urbana-Champaign

| PowerPoint PPT presentation | free to download

Genomic Repeat Visualisation Using Suffix Arrays PowerPoint PPT Presentation

Genomic Repeat Visualisation Using Suffix Arrays - A sliding window is ran over the entire sequence to divide it into all ... and Manufacturers' by Charles Babbage with artificial repeat inserted 16times. ...

A sliding window is ran over the entire sequence to divide it into all ... and Manufacturers' by Charles Babbage with artificial repeat inserted 16times. ...

| PowerPoint PPT presentation | free to view

Applying Pruning Techniques to SingleClass Emerging Substring Mining PowerPoint PPT Presentation

Applying Pruning Techniques to SingleClass Emerging Substring Mining - Class ... If database D is associated with m class labels, we can partition D into m ... A target class Ck is specified and our goal is to discover the set of ...

Class ... If database D is associated with m class labels, we can partition D into m ... A target class Ck is specified and our goal is to discover the set of ...

| PowerPoint PPT presentation | free to view

CYK Parser - CYK Parser. Von Carla und Cornelia Kempa. Overview. CYK Parser ... not only to annoy students ) Perfect grammar for CYK. How CYK works for. a grammar in CNF ...

CYK Parser. Von Carla und Cornelia Kempa. Overview. CYK Parser ... not only to annoy students ) Perfect grammar for CYK. How CYK works for. a grammar in CNF ...

| PowerPoint PPT presentation | free to download

IE by Candidate Classification: Jansche PowerPoint PPT Presentation

IE by Candidate Classification: Jansche - IE by Candidate Classification: Jansche & Abney, Cohen et al William Cohen 1/19/03

IE by Candidate Classification: Jansche & Abney, Cohen et al William Cohen 1/19/03

| PowerPoint PPT presentation | free to download

Text Categorization with All Substring Features PowerPoint PPT Presentation

Text Categorization with All Substring Features - Text Categorization with All Substring Features. Daisuke Okanohara, Jun'ichi Tsujii ... Lemma: Let P(s) be the position list of a substring s in a text d, and s and s' ...

Text Categorization with All Substring Features. Daisuke Okanohara, Jun'ichi Tsujii ... Lemma: Let P(s) be the position list of a substring s in a text d, and s and s' ...

| PowerPoint PPT presentation | free to view

Similarity join problem with Pass-Join-K using Hadoop PowerPoint PPT Presentation

Similarity join problem with Pass-Join-K using Hadoop---BY Yu Haiyang Hello everyone. Today I will give a short report about string optimization.

| PowerPoint PPT presentation | free to view

Genomic Repeat Visualisation Using Suffix Arrays - A sliding window is ran over the entire sequence to divide it into all ... Machinery and Manufacturers' by Charles Babbage with artificial repeat inserted 16times. ...

A sliding window is ran over the entire sequence to divide it into all ... Machinery and Manufacturers' by Charles Babbage with artificial repeat inserted 16times. ...

| PowerPoint PPT presentation | free to view

Comparative genomics to identify DNA binding motifs PowerPoint PPT Presentation

Comparative genomics to identify DNA binding motifs - species1. species2. species3. species4. EVOLUTIONARY TREE. Using multiple genomes ... species1. species2. species3. species4. Promoter 1. Promoter 2. Promoter 3 ...

species1. species2. species3. species4. EVOLUTIONARY TREE. Using multiple genomes ... species1. species2. species3. species4. Promoter 1. Promoter 2. Promoter 3 ...

| PowerPoint PPT presentation | free to view

An efficient algorithm for optimizing whole genome alignment with noise PowerPoint PPT Presentation

An efficient algorithm for optimizing whole genome alignment with noise - P. Wong, T. Lam, N. Lu, H. Ting, and S. Yiu ... Genes that have the same functionality among species. ... We investigate the optimization problem of finding an ...

P. Wong, T. Lam, N. Lu, H. Ting, and S. Yiu ... Genes that have the same functionality among species. ... We investigate the optimization problem of finding an ...

| PowerPoint PPT presentation | free to download

Fragment Assembly - Fragment Assembly Introduction Fragments are typically of 200-700 bp long Target string is about 30k 100k bp long Problem: given a set of fragments ...

Fragment Assembly Introduction Fragments are typically of 200-700 bp long Target string is about 30k 100k bp long Problem: given a set of fragments ...

| PowerPoint PPT presentation | free to download

Filtering XML Documents with XPath PowerPoint PPT Presentation

Filtering XML Documents with XPath - The Query Index is used to match documents to individual XPath queries ... Filtering XML documents using a strcuture-oriented path language such as XPath ...

The Query Index is used to match documents to individual XPath queries ... Filtering XML documents using a strcuture-oriented path language such as XPath ...

| PowerPoint PPT presentation | free to view

Text Comparison of Genetic Sequences PowerPoint PPT Presentation

Text Comparison of Genetic Sequences - Comparing Two Strings. If X and Y are strings, how similar are they? ... Cormode, G., Muthukrishnan, S., 'The String Edit Distance Matching Problem with Moves' ...

Comparing Two Strings. If X and Y are strings, how similar are they? ... Cormode, G., Muthukrishnan, S., 'The String Edit Distance Matching Problem with Moves' ...

| PowerPoint PPT presentation | free to view

When Cryptography Meets Storage PowerPoint PPT Presentation

When Cryptography Meets Storage - ... of legacy storage data path Single ... secure deletion system Goal is not ... systems used for confidential storage of data ...

... of legacy storage data path Single ... secure deletion system Goal is not ... systems used for confidential storage of data ...

| PowerPoint PPT presentation | free to download

Algorithms for Network Security PowerPoint PPT Presentation

Algorithms for Network Security - Algorithms for Network Security George Varghese, UCSD Network Security Background Current Approach: When a new attack appears, analysts work for hours (learning) to ...

Algorithms for Network Security George Varghese, UCSD Network Security Background Current Approach: When a new attack appears, analysts work for hours (learning) to ...

| PowerPoint PPT presentation | free to download

Objectives - Draw the control flow diagram for your Craps solution ... str = 'The Beatles' 10. 9. 8. 7. 6. 5. 4. 3. 2. 1. 0. s. e. l. t. a. e. B. e. h. T. index. of. characters ...

Draw the control flow diagram for your Craps solution ... str = 'The Beatles' 10. 9. 8. 7. 6. 5. 4. 3. 2. 1. 0. s. e. l. t. a. e. B. e. h. T. index. of. characters ...

| PowerPoint PPT presentation | free to view

The CYK Parsing Method PowerPoint PPT Presentation

The CYK Parsing Method - Recognition with a grammar in CNF. CYK Parsing with CNF ... (1) Example Grammar: A grammar describing numbers in scientific notation. Input: 32.5e 1 ...

Recognition with a grammar in CNF. CYK Parsing with CNF ... (1) Example Grammar: A grammar describing numbers in scientific notation. Input: 32.5e 1 ...

| PowerPoint PPT presentation | free to view

Combinatorial%20Pattern%20Matching PowerPoint PPT Presentation

Combinatorial%20Pattern%20Matching - Combinatorial Pattern Matching

Combinatorial Pattern Matching

| PowerPoint PPT presentation | free to download

Polygraph: Automatically Generating Signatures for Polymorphic Worms - Polygraph: Automatically Generating Signatures for Polymorphic Worms

Polygraph: Automatically Generating Signatures for Polymorphic Worms

| PowerPoint PPT presentation | free to download

Perl - Replace one set of characters with another, by position in list. tr /from/to/ #operates on ... How can you make a queue? Splicing Arrays. Similar to substring ...

Replace one set of characters with another, by position in list. tr /from/to/ #operates on ... How can you make a queue? Splicing Arrays. Similar to substring ...

| PowerPoint PPT presentation | free to download

Advisor: Prof. R. C. T. Lee PowerPoint PPT Presentation

Advisor: Prof. R. C. T. Lee - Two exact string matching algorithms using suffix to prefix rule. 2 ... the Boyer-Moore-Horspool algorithm, Baeza-Yates, R. A. and Regnier, M. Theoret. ...

Two exact string matching algorithms using suffix to prefix rule. 2 ... the Boyer-Moore-Horspool algorithm, Baeza-Yates, R. A. and Regnier, M. Theoret. ...

| PowerPoint PPT presentation | free to view

Applications of Suffix Trees PowerPoint PPT Presentation

Applications of Suffix Trees - Applications of Suffix Trees Dr. Amar Mukherjee CAP 5937 ST: Bioinformatics University of central Florida 7.1 Exact String Matching Three important variants: Both ...

Applications of Suffix Trees Dr. Amar Mukherjee CAP 5937 ST: Bioinformatics University of central Florida 7.1 Exact String Matching Three important variants: Both ...

| PowerPoint PPT presentation | free to download

Suffix Trees and Suffix Arrays PowerPoint PPT Presentation

Suffix Trees and Suffix Arrays - How do you solve these problems (efficiently)? Exact string ... http://home.in.tum.de/~maass/suffix.html. http://homepage.usask.ca/~ctl271/857/suffix_tree.shtml ...

How do you solve these problems (efficiently)? Exact string ... http://home.in.tum.de/~maass/suffix.html. http://homepage.usask.ca/~ctl271/857/suffix_tree.shtml ...

| PowerPoint PPT presentation | free to download

String Matching Algorithms Based upon the Uniqueness Property PowerPoint PPT Presentation

String Matching Algorithms Based upon the Uniqueness Property - Given a text string T of length n and a pattern string P of length m. ... For any substring V of P, if V occurs in P only once, V is a unique substring. ...

Given a text string T of length n and a pattern string P of length m. ... For any substring V of P, if V occurs in P only once, V is a unique substring. ...

| PowerPoint PPT presentation | free to view

PHP Strings - PHP Strings

PHP Strings

| PowerPoint PPT presentation | free to view

Combinatorial Pattern Matching PowerPoint PPT Presentation

Combinatorial Pattern Matching - This leads us to a different problem, the Pattern Matching Problem ... When threading is 'complete,' we've found a pattern in the text ...

This leads us to a different problem, the Pattern Matching Problem ... When threading is 'complete,' we've found a pattern in the text ...

| PowerPoint PPT presentation | free to download

Combinatorial Pattern Matching - ... Needleman-Wunsch global alignment algorithm 1981: Smith-Waterman local alignment algorithm 1985: FASTA 1990: BLAST (basic local alignment search tool) ...

... Needleman-Wunsch global alignment algorithm 1981: Smith-Waterman local alignment algorithm 1985: FASTA 1990: BLAST (basic local alignment search tool) ...

| PowerPoint PPT presentation | free to download

Efficient Text and Semi-structured Data Mining: Towards Knowledge Discovery in the Cyberspace PowerPoint PPT Presentation

Efficient Text and Semi-structured Data Mining: Towards Knowledge Discovery in the Cyberspace - CACA. TGTTTCTGT. AGGAGGT. Web pages, XML/SGML archives. Genome databases. E-mails, text files ... CACA. AGGAT. CCAA. CACA. AGGAT. CCAA. GTGTCACAAATTCTGTAGTATCA ...

CACA. TGTTTCTGT. AGGAGGT. Web pages, XML/SGML archives. Genome databases. E-mails, text files ... CACA. AGGAT. CCAA. CACA. AGGAT. CCAA. GTGTCACAAATTCTGTAGTATCA ...

| PowerPoint PPT presentation | free to view

Suffix Trees PowerPoint PPT Presentation

Suffix Trees - By rule2 no problem traversing an edge Biology easily has 500 years of exciting problems to work on. Donald Knuth web.ist.utl.pt/joao.carreira Questions?

By rule2 no problem traversing an edge Biology easily has 500 years of exciting problems to work on. Donald Knuth web.ist.utl.pt/joao.carreira Questions?

| PowerPoint PPT presentation | free to download

When Cryptography Meets Storage - Cryptographic systems used for confidential storage of data ... Old versions may still linger on raw storage, even though application can only ...

Cryptographic systems used for confidential storage of data ... Old versions may still linger on raw storage, even though application can only ...

| PowerPoint PPT presentation | free to view

Substrings PowerPoint PPT Presentations