Case Studies - PowerPoint PPT Presentation

1 / 10
About This Presentation
Title:

Case Studies

Description:

Three out of 42 elderly-patients is being transported to ICU for close monitoring. ... Legionnaire's disease: Pneumonia. Flu-like Pontiac fever. Further information ... – PowerPoint PPT presentation

Number of Views:85
Avg rating:3.0/5.0
Slides: 11
Provided by: hana1
Category:

less

Transcript and Presenter's Notes

Title: Case Studies


1
Case Studies 2Hospice Outbreak
  • Hana Lim Carol Chaffee

2
Scenario
  • 42 patients and entire of kitchen dish washing
    staff at Philadelphia Hospice complained of
    chronic diarrhea, vomiting and flu-like symptom
    since a plumbing repair on Jan. 7.
  • Two children developed flu-like symptoms since
    they began spending the day with their
    grandparents at the center since Jan. 10.
  • Four nurses were sent home complaining of
    debilitating nausea and confusion on Jan. 22.
  • Three out of 42 elderly-patients is being
    transported to ICU for close monitoring.

3
  • Two out of three elderly patients in ICU died of
    pneumonia and the third patient is responding to
    treatment and has stabilized.
  • Four more patients admitted to the hospital with
    body temperatures over 103 F.
  • 20 other elderly went back home complaining of
    fatigue, headache and nausea.
  • The nurses still feel tired and they cough
    frequently during smoke break.
  • Kitchen staff are better, however, complain of
    confusion

4
Hypothesis
  • Legionella
  • Aquatic biofilms
  • Symptoms appear within 2-10 days after exposure
  • Headache, nausea, vomiting, and stomach
    discomfort
  • For several days, the patient may feel tired and
    weak.  Most patients who are admitted to the
    hospital develop high fever often greater than
    39.5C (103F)
  • Legionellosis is an infectious disease caused by
    bacteria belonging to the genus Legionella which
    takes two distinct forms
  • Legionnaires disease Pneumonia
  • Flu-like Pontiac fever

5
Further information
  • How many of the patients, nurses, and kitchen
    staff are smokers?
  • 9 of 42 patients, all 4 nurses, and none of 5
    dishwashers were smokers
  • Are the patients who have been affected suffering
    from other conditions that may have impaired
    their immune system or lung function?
  • Two resident patients who died suffered from lung
    cancer
  • The third patient has emphysema and was sent home
    on oxygen
  • The four later admitted to the hospital are
    considered to have impaired immune system
  • The Nature of the plumbing repairs? Were any
    water tanks, especially hot water reservoirs,
    involved?
  • Yes
  • Have any other people in the households of
    affected individuals developed any symptoms?
  • No. None of the households of the infected
    individuals have reported symptoms

6
Culture-based technique
  • Phlegm samples that were produced by affected
    individuals Water samples from inside of faucet
  • Buffered Charcoal Yeast Extract (BCYE)Agar
    L-Cysteine Fe
  • 5 days _at_ 37C
  • Result
  • There were colonies growth
  • Characteristic Legionella colonies white-gray to
    blue-gray

7
PCR test
  • MoBioClean Microbial DNA Isolation Kit
  • Primer set was designed This primer set targets
    a large number of Legionella variants, but does
    not amplify non-Legionella organism.
  • Band appearing at approx. 1000 bp on a gel may be
    presumed Legionella.
  • Target gene hsp60(specific gene that can be
    found in Legionella)
  • Forward Primers TGTTGAAGGTCACAAGGCAG
  • Reverse Primers CACCGGCAACAATACCTTCT
  • All PCR products had be run on a 1.2 agarose gel
    with TAE buffer and we expected a correctly sized
    product that appear at approximately 1000 bps

8
DNA extracts (Colonies, phlegm, water, and
controls)
  • The purified DNA from Colonies, Phlegm, and water
    sample went into PCR reaction
  • As controls, DNA extracts from pure cultures of
    any Legionella strain (Positive control),
    Streptococcus pneumoniae and E. coli (negative
    controls) were tested too.

9
Result from PCR test
  • Two of the three types of colonies from which DNA
    was extracted showed a distinct band at 944 bps
  • 16 out of 18 gels of DNA from phlegm samples of
    18 individual patients also showed dark bands at
    approximately 944 bps.
  • The PCR detection failed from the water samples.
  • The amount of DNA extracted from these samples
    was below detectable levels.
  • Neither negative control showed a product at 1000
    bps, while the positive control showed a
    distinct, dark band at 944 bps.

10
Conclusion
  • It is clearly proved that this outbreak was
    caused by Legionella!
Write a Comment
User Comments (0)
About PowerShow.com