Ancient DNA Diagnosis of Canine Tuberculosis

1
Ancient DNA Diagnosis of Canine Tuberculosis
Introduction

• An unusual dog burial was recovered from the
  Cleveland site, a 16th C horticultural Neutral
  Iroquois village in eastern Canada.
• Cleveland was a proto-historic village located
  in south-central Ontario, Canada, 14C dated to AD
  154090, with limited evidence of European
  artifacts on site (1 13).
• The dog, a mature male (14), medium size (ESH
  46.5cm --4), 2 years of age (7 15), was 1 of 3
  discrete canine bundle-burials excavated from
  site middens, and was found well-preserved,
  mostly complete and ...articulated and
  enmeshed within a pot (Burns, 1973 3).
• The dog displays the pathological skeletal
  syndrome, hyperpulmonary osteoarthropathy (HPOA),
  a rare and treatable condition in modern dogs.
• The case was first documented by Burns (1973)
  and the diagnosis of canine HPOA was made by Dr.
  T. Hullard, Dean of the Ontario Veterinary
  College.

Cleveland site (AhHb-7) South-central
Ontario Canada
Southern Ontario
New York USA
Cleveland
Skeletal Pathology
lumbar
thoracic
Canine Hyperpulmonary Osteoarthropathy (HPOA)
Definition

• A progressive, symmetric and bilateral
  periosteal reaction (6 10 11) secondary to
  chronic lung conditions.
• Primarily involves areas of membranous or
  tendonous attachment on the distal portions of
  the radius, ulna, tibia, fibula, metacarpals and
  metatarsals (6 12).

Vertebrae
Phalanges
Left calcaneus metatarsals
Tibia partial fused fibula
Ulna
Skull lateral view
Skull dorsal view
Ossified granuloma articulates with innominate
Radius
III
II
Right mandible medial
Left mandible lateral
Left metacarpals
Sites of infection on Cleveland dog
R. caudal
L.
L. cranial
Interpretation Cultural Significance
V
R.
IV
II
V
III
IV
L.
R.

• The site middens contain butchered and
  disarticulated dog remains this dog was interred
  differently and bears no such evidence,
  indicating a clear cultural distinction between
  food and pet.
• Due to this cultural bond and the highly
  infectious and transmissible nature of TB (3 5
  9), it is possible that this dog was either
  infected by or passed the infection to its human
  caregiver(s).
• A discrete burial after death combined with
  obvious chronic illness indicates human nurturing
  while the dog was living -- it was neither
  prematurely destroyed nor carelessly discarded.
• Dogs can be considered proxies of human health
  conditions in antiquity due to the close,
  cultural context of dogs and humans who share
  living areas, food, labour and affection.

aDNA Analysis
Methods
Sequence of Amplified TB DNA
Amplified Ancient DNA

• DNA was extracted from two carpals using
  protocol C described by Yang et al. (1998).
• Canine mitochodrial DNA (mtDNA) was amplified
  using primers CMT1 5-TCGAGGCATGGTGATTAAG and
  CMT2 5 ACCCCTACATTCATATATTGAAT with
  parameters described by Ishiguro et al. (2000).
• GeneAmp Thermocycler 2400 (PerkinElmer) was
  used for all amplifications.
• Mycobacterium tuberculosis complex DNA was
  amplified using nested primers specified by
  Taylor et al. (1996).
• Reactions in a 50ml volume contained 50mM KCl,
  10mM Tris-HCl, 3mM MgCl2, 0.2 mM dNTP, 1.0 mg/ml
  BSA, 20 pmol of each primer, 5µl DNA and 2.5U of
  AmpliTaq Gold (PerkinElmer). PCR conditions for
  123bp fragment of IS6110 initial denaturation
  12min at 95C followed by 40 cycles of
  denaturation at 94C for 30sec, annealing at 66C
  for 1min, extension at 72C for 1min. Nested
  92bp fragment - with fresh reagents and 3µl of
  first round product 30 cycles with annealing at
  58C for 30sec.
• PCR product of nested TB reaction was purified
  using QIAquick purification kit and directly
  sequenced on ABI Prism 3100 Genetic Analyzer
  (Applied Biosystems Inc).

Results

• Canine mtDNA was amplified confirming presence
  of endogenous DNA
• The 92bp fragment of IS6110, amplified and
  sequenced, confirms the presence of Mycobacterium
  tuberculosis complex DNA in the dog implicating
  the bacterium as the causative agent in this case
  of canine HPOA.
• All negative controls were negative throughout
  and no positive controls were used, thereby
  eliminating the risk of contamination with modern
  DNA.

Conclusions

• Tuberculosis was the causal agent in this case
  of canine hyperpulmonary osteoarthropathy (HPOA)
  from an early contact-era First Nation site in
  Canada.
• This is the first palaeogenetic evidence of TB
  to be isolated from an archaeological dog.
• Evidence of the skeletal syndrome HPOA can be
  considered as a possible indication of TB
  infection in dogs.
• This study emphasizes the potential for using
  dogs as human proxies in palaeo-epidemiological
  studies of ancient health and disease.

Rhonda R. Bathurst Jodi Lynn Barta
Acknowledgments We are grateful to Shelley
Saunders and the McMaster Palaeogenetics
Institute for providing laboratory facilities for
this analysis. Dennis Ng for his technical
assistance. Ann Herring , Aubrey Cannon and
Tanya von Hunnius for their helpful comments.
Dave Milne for his printing services. Funding was
provided by the Social Sciences and Humanities
Research Council of Canada (SSHRC), Graduate
Student Association at McMaster (RRB), and the
SAAs Dienje Kenyon Inaugural Fellowship (RRB).
Department of Anthropology
McMaster University
Canada