Listeria monocytogenes

1
(No Transcript)
2
E. coli 0157H7 A New Emerging Disease

• 1982 First recognized as pathogen
• 1983 Linked to hemolytic uremic syndrome
• 1990 Outbreak from drinking water
• 1991 Outbreak from apple cider
• 1993 Large outbreak from hamburgers

3
E. coli 0157H7 Clinical Manifestations

• Condition
• Asymptomatic carriage
• Nonbloody diarrhea
• Hemorrhagic colitis
• Hemolytic-uremic syndrome
• Complications of enteric infection

Frequency Unknown 10 90 10 lt10 years lt5
Clin Infect Dis 1995201
4
Barium-enema showing thumbprinting in colon of
child with E. coli O157H7 hemorrhagic colitis,
due to edema and submucosal hemorrhage
N Engl J Med 1995333364
5
Colonic biopsy from patient with E. coli O157H7
infection
Biopsy showing ischemic injury with superficial
coagulative necrosis, mucosal hemorrhage, and an
overlying inflammatory pseudomembrane
N Engl J Med 1995333364
6
Hemolytic Uremic Syndrome

• Days to 2 weeks after gastroenteritis
• Pallor, bruising, lethargy
• Anemia (Hgb5-7 mg/dl), thrombocytopenia
• Hematuria, acute renal failure
• Death 3-5
• E. coli O157H7 isolated from 96 of patients
  when culture performed within 6 days of onset

7
Pathogenesis of E. coli O157H7 infection
8
Incidence of E. coli O157H7 infection,United
States
Source CDC
9
Outbreaks of E. coli 0157H7reported to CDC,
1982-1994

• Vehicle
• Ground beef
• All beef milk
• Water (drinking/swimming)
• Person-to-person
• Unknown
• All outbreaks

No. outbreaks 22 26 3 9 19 69
No. persons 1,137 1,278 276 243 274 2,334
Epidemiol Rev 19961829
10
Outbreaks of E. coli 0157H7reported to CDC,
1982-1994
Epidemiol Rev 19961829
11
E. coli 0157H7 Vehicles of infection

• Undercooked hamburgers
• Bovine manure
• Contaminated water (e.g., lakes, water slides)
• Alfalfa sprouts
• Mayonaise
• Unpasteurized apple cider
• Unpasteurized milk

12
E. coli 0157H7 in food

• Present in any food w/bovine fecal contamination
• Infectious dose probably lt5 organisms
• Present in 1-2 of ground beef, pork, poultry,
  lamb retail meat samples in Madison, WI
• Present in about 10 of raw milk samples

Epidemiol Rev 19961829
13
Geographic distribution of E. coli O157H7 Total
Number of Reported Cases, 1996
14
Cases of foodborne illness,selected pathogens,
1995

• Pathogen
• Salmonella
• Campylobacter
• E. coli O157H7
• Clostridium perfringens
• Listeria monocytogenes
• Staphylococcus aureus

• Cases
• 696,000-3,840,000
• 1,100,000-7,000,000
• 8,000-16,000
• 10,000
• 928-1,767
• 1,513,000

Deaths 870-1,920 110-511 176-433 100 230-485 454
15
Onset of E. coli O157H7 infections and HUS, Dec.
1, 1992-Feb. 28, 1993, Washington State
Black bars indicate primary cases shaded bars,
secondary cases and white bars, unclassified
cases

• 631 cases reported (501 cult. confirmed)
• Median age 8
• 45 cases of HUS, 3 died
• Median incubation 4 days
• Undercooked burgers at chain A, 58/64
  restaurants had at least 1 case
• Burgers cooked 1 minute/side routinely
  associated with internal temp. lt68.3 C
• Molecular epidemiology single clone

Click for larger picture
JAMA 19942721349
16
E. coli 0157H7 at the Washington County Fair,
New York, 1999

• 921 persons reported diarrhea
• E. coli 0157H7 isolated from 116 persons 13
  coinfected with Campylobacter jejuni
• 32 infected with C. jejuni alone
• 65 persons hospitalized, 11 children w/HUS
• 2 deaths 3 yo w/HUS and 79 yo w/HUS/TTP
• Source consumption of water from shallow
  unchlorinated well

MMWR 199948803
17
Outbreak of E. coli O157H7 Among Children
Associated With Farm Visits Montgomery County,
PA, 2000

• September-November 2000 Montgomery County HD
  identified 51 persons with diarrhea lt10 days of
  visiting a dairy farm (farm A)
• Age range 1-52 years (median 4 years)
• Bloody diarrhea (37), fever (45), vomiting
  (45)
• 16 patients were hospitalized and eight
  developed HUS

MMWR 200150293
18
Outbreaks of E. coli O157H7 Among Children
Associated With Farm Visits Molecular
Epidemiology

• Isolates from patients indistinguishable by PFGE
• All 216 cattle on Farm A cultured by rectal swab
• 28 (13) positive for outbreak strain
• Same strain isolated from railing surface

MMWR 200150293
19
CDC Investigator Examines aCalf at Farm A,
Pennsylvania, 2000
MMWR 200150293
20
Outbreaks of E. coli O157H7 Among Children
Associated With Farm Visits Case-Control Study
of Risk Factors

• Exposure
• Contact with cattle
• Nailbiting
• Food from concession
• Handwashing before eating

Odd ratio (95 CI) 10.9 (1.7-70.7) 2.5
(1.1-5.7) 2.5 (1.1-5.7) 0.2 (0.1-0.7)
MMWR 200150293
21
Routine DNA Fingerprinting by Health Departments
E. coli O157H7, Minnesota, 1995
N Engl J Med 1997337388
22
Patterns on Pulsed-Field Gel Electrophoresis of
E. coli O157H7 in Minnesota
Lanes 1, 6, 10 E. coli 0157H7 standard Lane 5
add. mole. wt. standard Lanes 2, 4, 7, 8
sporadic cases Lanes 3, 9 isolates from single
cluster
N Engl J Med 1997337388
23
Routine DNA Fingerprinting by Health Departments
E. coli O157H7, Minnesota, 1995
Click for larger picture
N Engl J Med 1997337388
24
Routine DNA Fingerprinting by Health Departments
E. coli O157H7, Minnesota, 1994
Click for larger picture
N Engl J Med 1997337388
25
Confirmed E. coli O157H7 outbreaksin Minnesota,
1994 and 1995
Click for larger picture
N Engl J Med 1997337388
26
Molecular subtyping of E. coli 0157H7 has
revolutionized population-based surveillance for
this organism in Minnesota. We now routinely
subtype all E. coli 0157H7 isolates and
consider this technique to be an integral part of
disease prevention and control in our state.
Minnesota Department of HealthN Engl J Med
1997377388
27
The Colorado Department of Public Health recently
identified an outbreak of E. coli 0157H7
infection associated with . . .six lots of Hudson
foods frozen ground beef patties and burgers. On
August 7, 1997, CDPHEs public health laboratory
reported that 15 of 27 E. coli isolates
submitted for routine molecular subtyping since
June 1 were characterized by highly related PFGE
patterns. . .
CDCMMWR 199746777.
28
PFGE patterns of Salmonella enterica serotype
Typhimurium, by Week, Minnesota, June -

September 1995
Click for larger picture
N Engl J Med 2001 344189
29

• Coordinated by CDC
• National network of PH labs that performs PFGE on
  foodborne bacteria
• Salmonella serotype Typhimurium
• Escherichia coli 0157H7
• Others planned
• Permits rapid comparison of PFGE patterns through
  electronic database at CDC
• Pennsylvania Department of Health participates

www.cdc.gov/ncidod/dbmd/pulsenet/pulsenet.htm
30
Prevention

• Surveillance for E. coli 0157H7 and HUS
• Modernization of food inspection
• Education of physicians
• Education of public

31
Limitations of Pulsed-Field Gel Electrophoresis

• Substantial intra-/inter-laboratory variation
• Interpretation of banding patterns subjective
• Requires additional enzymes to prove matches
• Analyzing across gels difficult
• PFGE stored as large image files
• Requires isolation of the organism
• Slow
• Ongoing, automated computer analysis difficult

32
Chain Termination DNASequencing (Sanger Method)
A New DNA synthesized as polymerase moves down
template DNA, away from primer
B Nucleotides added until dideoxynucleotide
incorporated.
C Labeled primer
D Labeled deoxynucleotides
Click for larger picture
E Labeled dideoxynucleotides
33
Multilocus Sequence Typing (MLST)

• Sequencing of multiple housekeeping genes
• State of the art (human genome project)
• Objective no need to compare banding patterns
• Standardization of methods
• Fully reproducible
• Storage, transmission, analysis of ASCII files
• More appropriate for ongoing, automated computer
  analysis
• Do not need to isolate organism in culture
• Fast

34
Sequence v. PFGE Data
TTCGAATAAGCTTCCCTGAG AAGCTTATTCGAAGGGACTC
35
Serratia marcescens outbreak in a NICU
Strain A isolates

• Mar-Jul 1995, 23 cases
• Mostly sepsis, 30 died
• 2 simultaneous outbreaks
• Most strain A, 4 E
• Contamination between NICU () and 2 other wards
  ( and )

J Clin Microbiol 1996343138
36
Cluster of Serogroup C Meningococcal Disease
Associated With a Party

• Case 1. 18-year-old male with headache, fever,
  nausea, vomiting on May 19, 1999. On May 20,
  presented with cardiopulmonary arrest and died.
  Blood cultures grew N. meningitidis.
• Case 2. 20-year-old male presented with
  headache, back pain, and lethargy on May 21.
  Blood cultures positive for N. meningitidis.
• Case 3. 21-year-old male, with headache, neck
  pain, vomiting, hypotension on May 25, 1999.
  Blood cultures positive for N. meningitidis
• Common exposure Attendance at a (wild!) party
  on May 14

S Med J, in press
37
Cluster of Serogroup C Meningococcal Disease
Associated With a Party PFGE Analaysis (SpeI)
Lanes 1, 6, 10 lambda ladder reference, lanes 2,
3, 4 N. meningitidis isolates from Cases 1, 2,
and 3 respectively lanes 5, 7, 8, 9 Group C
N. meningitidis control isolates from 1999
1 2 3
4 5 6 7 8 9 10
S Med J, in press
38
Routine Molecular Epidemiology for Enhanced
Detection and Control of Foodborne Outbreaks
Summary

• Routine molecular subtyping of key pathogens of
  public health importance leads to enhanced
  detection of foodborne outbreaks
• Routine molecular subtyping should be an integral
  part of public health surveillance
• DNA sequence-based methods may eventually replace
  restriction enzyme-based methods