Title: Gene expression
1GCCTCAATGGATCCACCACCCTTTTTGGGCAGCCTCAATGGATCCACCAC
CCTTTTTGGTGCAAGCCTCAATGGATCCACCACCCTTTTTGGTGCAAGCC
TCAATGGATCCACCACCCTTTTTGGTGCAAGCCTCAATGGATCCACCACC
CTTTTTGGTGCAAGCCTCAATGGATCCACCACCCTTTTTGGTGCAAGCCT
CAATGGATCCACCACCCTTTTTGGTGCAGCCTCAATGGATCCACCACCCT
TTTTGGGCAGCCTCAATGGATCCACCACCCTTTTTGGTGCAAGCCTCAAT
GGATCCACCACCCTTTTTGGTGCAAGCCTCAATGGATCCACCTCCACCAC
CCTTTTTGGTGCATGTGCCATGGC
2(No Transcript)
3- Gene expression
- Transcription
- Translation
- Functional proteins post-translational
modifications - Phosphorylation
- Glycosylation
- Sorting targeting to appropriate organelles
- Modulation by extracellular signals
- Covalent modification
- Association with other molecules
- Degradation
4Sorting and Secretory pathways
- diverged in trans-Golgi
- Constitutive pathway
- many soluble proteins
- Regulated pathway
- stored in secretory vesicles
- active transport from cytosol to vesicles
- complexed with macromolecules (e.g. proteglycans)
5Regulated secretory pathway
- In response to extracellular stimuli hormone,
transmitters, digestive enzymes - stored in secretory vesicles
- active transport from cytosol to vesicles
- complexed with macromolecules (e.g. proteglycans)
to reach high concentration
6(No Transcript)
7Three pathways in Golgi
- to lysosome
- with mannose-6-phosphate, via late endosome to
lysosome - to secretory pathways
- Constitutive to apical or basolateral domain
- Regulated
8(No Transcript)
9Roadmap for traffic
- Transport
- Gated transport cytosol and nucleus via nuclear
pore complexes - Membrane transport via membrane-bound
translocators unfolded - Vesicle transport vesicles
- Sorting signals
10Membrane transport
- Membrane-bound translocators
- Unfolding of protein to be transported
- Passing through a topologically distinct space
cytosol to ER cytosol to mitochondria
11Equivalent space for transport
- Cycles of budding and fusion permits transport of
molecules
12Sorting signals
- Signal sequences
- 15-60 aa
- Removed by signal peptidase when reaching the
target - Signal patch
- Usually non-continuous stretch of sequences
- Exposed when appropriately folded
13Sorting signals
14Signal sequences
- Function specify the direction for destination
- for initial transfer to the ER with a signal
sequence at N-terminus consisting of 5-10
hydrophobic aa - Go forward Golgi most proteins
- Return to ER (ER residents) with a specific
sequence of 4 aa at C-terminus - Go to mitochondria positively charged amino
acids alternate with hydrophobic ones - Go to peroxisome with a signal peptide of 3
characteristic at C terminus
15Signal sequences
16Experiments to demonstrate zip code
- Swap the signal sequence
- e.g. adding the ER signal sequences to a
cytosolic protein results in the retention of
this protein in ER - Hyprophobicilty maybe a determing factor of
signal sequences
17Günter Blobel
18Effect of misdirected protein
19(No Transcript)
20Overview of protein sorting
21Protein sorting
- ER
- ER-Golgi intermediate
- Glogi network
22Glycosylation in ER
23Lysosomal protein phosphorylation of mannose
24Sorting in Golgi
- Export
- Lysosome
- Secretion
- Constitute
- Regulated
- Retain in Golgi
- transmembrane
25Transport to plasma membrane
- TGN
- Apical domain
- Basolateral domain
26Endocytosis
- Phagocytosis (cell eating)
- Ingestion of large particles (e.g. bacteria)
- In specialized cells
- Pinocytosis (cell drinking)
- Up-take of fluids or macromolecules in small
vesicles - Receptor-mediated endocytosis
- Common among eukaryotic cells
27Phagocytosis
- Pseudopodia
- Phagosome
- Phagolysosome
28Receptor-mediated endocytosis
- Clathrin-coated pits
- Clathrin-coated vesicles
- Example cholesterol, LDL, LDL receptor
29LDL low density lipoprotein
- Core
- 1500 Cholesterol ester
- Coat
- 500 cholesterol
- 800 phospholipid
- 1 Apoprotein B100
30LDL receptor
- MS Brown, JL Goldstein
- Familial hypercholesterolemia
- LDL-binding domain
- Internalization signal
31LDL receptor
- Internalization signal Tyr
32Clathrin-coated pits
33Lysosomal proteins in clathrin-coated pits
34Sorting in early endosome
- Acidic ph by H pump for dissociation of proteins
35Recycling of synaptic vesicles
36Protein sorting by transcytosis
- Membrane protein in apical domain
- Secretory proteins from bloodstream
37Lysosomal system
- For membrane-bound proteins and proteins taken by
endocytosis - Multiple acid proteases (cathepsins) and other
hydrolases - Studied with weak bases to inhibit lysosomal
acidification or lysosomal inhibitors (E64)