Answers to Biotech Jeopardy

1
Answers to Biotech Jeopardy
2

• Biotechnology Test Review Questions
• Easy
• Small, circular piece of bacterial DNA is called
  a ____.
• Give two examples of vectors
• The entire collection of genes within human cells
  is called the _______________.
• Difference between technology and biotechnology?
• Function of restriction enzymes?
• HGP stands for? How many base pairs in HG? How
  many proteins?
• Difference between surrogate and biological
  mother?
• A _____________ is caused by a defective or
  mutant gene.
• Define gene.
• The first cell created by sexual reproduction is
  called a

3

• Biotechnology Test Review Questions
• Easy
• Small, circular piece of bacterial DNA is called
  a ____.
• Give two examples of vectors
• The entire collection of genes within human cells
  is called the _______________.
• Difference between technology and biotechnology?
• Function of restriction enzymes?
• HGP stands for? How many base pairs in HG? How
  many proteins?
• Difference between surrogate and biological
  mother?
• A _____________ is caused by a defective or
  mutant gene.
• Define gene.
• The first cell created by sexual reproduction is
  called a

4

• Medium
• 1. Inserting unrelated pieces of DNA together
  will result in ____________________.
• 2. IVF stands for? What is a synonym used for
  IVF?
• 3. What does transgenic mean?
• 4. Identical twins are considered to be genetic
  ___________.
• 5. How does IVF work? What does the female have
  to do? What does the male have to do?
• 6. Why does IVF sometimes result in twins,
  triplets, or quads?
• 7. Difference between fraternal vs. identical
  twins?
• 8. How does Gel Electrophoresis separate DNA
  fragments?
• 9. What is an example of a genetic disease?
• 10. What kind of ethical questions arise from
  IVF?

5

• Medium
• 1. Inserting unrelated pieces of DNA together
  will result in ____________________.
• 2. IVF stands for? What is a synonym used for
  IVF?
• 3. What does transgenic mean?
• 4. Identical twins are considered to be genetic
  ___________.
• 5. How does IVF work? What does the female have
  to do? What does the male have to do?
• 6. Why does IVF sometimes result in twins,
  triplets, or quads?
• 7. Difference between fraternal vs. identical
  twins?
• 8. How does Gel Electrophoresis separate DNA
  fragments?
• 9. What is an example of a genetic disease?
• 10. What kind of ethical questions arise from
  IVF?

6

• Disease Huntingtons disease, sickle cell anemia,
  cystic fibrosis
• Ethical questions
• Will anyone be harmed?
• What will be done with the extra embryos?
• Who will pay the cost?
• Do all involved parties agree?
• Is it safe for the mother and embryo?

7

• Difficult
• What is the difference between gene therapy and
  genetic engineering?
• Difference between a hybrid and chimera?
• Steps of genetic engineering?
• The Hind R1 restriction enzyme is used to slice
  DNA at the GAATTC between the G and C.
  Illustrate how this enzyme would precisely cut
  the fragment
• ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA
• TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT
• What research can be done using gel
  electrophoresis?

8

• Difficult
• What is the difference between gene therapy and
  genetic engineering?
• Difference between a hybrid and chimera?
• Steps of genetic engineering?
• The Hind R1 restriction enzyme is used to slice
  DNA at the GAATTC between the G and C.
  Illustrate how this enzyme would precisely cut
  the fragment
• ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA
• TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT
• What research can be done using gel
  electrophoresis?

9

• Hybrid has DNA from 2 organism in each cell
• Chimera has cells from different organisms in the
  body