Title: Multi Locus Sequence Analysis MLSA as an alternative to Whole DNADNA Hybridization WDDH in Borrelia
1Multi Locus Sequence Analysis (MLSA) as an
alternative to Whole DNA/DNA Hybridization (WDDH)
in Borrelia burgdorferi sensu lato Taxonomy.
- Guy BARANTON and Daniele POSTIC
- INSTITUT PASTEUR Paris, FRANCE
2B. burgdorferi sensu lato, a complex of species
Non pathogenic species
Pathogenic Species
B.valaisiana B. lusitaniae B. bissettii B.
sinica B. andersonii B. japonica B. turdi B.
tanukii B. spp.
B. burgdorferi sensu stricto
B. afzelii
B. garinii
Preferential Tropism
articular
cutaneous
neurologic
3Geographic Distribution of B. burgdorferi sensu
lato
I. ricinus B. garinii B. afzelii B. burgdorferi
ss B. valaisiana B. lusitaniae Borrelia spp
I. persulcatus B. garinii B. afzelii
B. japonica I. ovatus B. turdi I.
turdus B. tanukii I. tanuki
I. pacificus
B. burgdorferi ss
I. scapularis
I. dentatus B. andersonii
I. spinipalpis B. bissettii Borrelia spp
4WDDH is considered as the gold standard in
taxonomy
- The species criteria have been formalized in
1987 - 70 or more whole DNA relatedness within a
species - - DTm lower than 5C within a species
- Both criteria should be taken in consideration
- (Wayne L. G., Brenner D. J.et al. IJSB 1987
37463-464)
5WDDH advantages and inconvenients
- - WDDH indeed reflects the true evolutive
distances between two genomes, however - - Time consuming and restricted to experienced
labs - - Delineation of a new species requires
experiments with all previously known species -gt
increasing work and large collections of bacteria - - Not quite reproducible from one experiment to
another - - High cost
6- MLST has been used to replace MLEE
- It uses a cluster analysis procedure which
supposes some constraints - - to target housekeeping genes (both because they
were previously used in MLEE and they are
chronometric genes - - To use sequences of about 400bp from /_ seven
loci which warrant optimal allelic diversity.
7- Gevers, D. al. (2005). Nature Rev Microbiol 3,
733-739. - Suggest to use MLSA adapted from MLST in
prokaryotic taxonomy. - Our proposal is to sequence diverse fragments of
loci representative of the large genetic
diversity of the whole genome. - It would realize a sort of abstract of the
concerned bacterial genome
8- MLSA constraints are different from MLST ones
- (distances method instead of cluster analysis)
- - Large diversity of loci conserved/variable
chronometric/adaptative, chromosomal/plasmidic,
coding/non coding - - The size of the loci is not criticable, a high
number is to be preferred. Whole size about
1/1000 of the genome - - To avoid loci often laterally transferred and
then to prefer informational genes instead of
operational ones.
9-
- Borrelia spielmanii
- This species has been published by D. Richter in
2004 (Appl Environ Microbiol 70, 6414-6419) but
could not be validated because of the lack of
DNA/DNA relatedness values. - These isolates have been isolated in France from
I. ricinus collected on dormice. However half of
the sequences of rrf-rrl intergenic spacer
typical for B. spielmanii in databank were from
human.
10The newness of the method implies a 3 steps
strategy
- Step 1 To assess the method
- Sequencing of the 7 loci from several strains
of each known species in Europe. Comparaison of
the distances deduced from the concatenated
sequences with the DNA/DNA relatedness values
previously obtained for the concerned strains
11The newness of the method implies a 3 steps
strategy
- Step 2 Same strategy on the species known in
North America including atypical strains which,
studied by WDDH lead to border-line results and
could not be classified this way. - Delineation of potential new genomospecies
12The newness of the method implies a 3 steps
strategy
- Step 3 Both Borrelia sp. and B. valaisiana
strains (considered as non monophyletic) from
Europe wich have not be submitted to WDDH will be
studied by MLSA. - Finally, the simultaneous phylogenetic
treatment of the concatenated sequences from all
the studied isolates, whatever the continent they
originated from, should allow to suggest
relationships between species and genomospecies.
13- Material and Methods
- - 42 isolates 19 for step 1, 16 for step2 and
all 42 for step3 - - seven loci sequenced in both directions
- - Alignment with Clustal W, concatenation with
Word, phylogenetic analysis with Mega 3.
14Table 2. Characteristics of the amplified
fragments and corresponding primer sequences.
Numbering derives from Borrelia burgdorferi s.s.
strain B31T.
- Locus Length Primers Sequence
analysed - rrs 522 F AGAGTTTGATCCTGGCTTAG (10-29)
30-551 - R
CTTTACGCCCAATAATCCCGA (572-552) - fla 457 F AACACACCAGCATCACTTTCAGG (475-497)
497-844 - R
GATTWGCRTGCGCAATCATTGCC (976-954) - groEL 268 F TACGATTTCTTATGTTGAGGG (552-572)
573-840 - R
CATTGCTTTTCGTCTATCACC (861-841) - hbb 327 F GCGAAGAATTCATAAAAATAAGGCTGC (-79 -53
) 1-327 - R
TATAAGAATTCACGATATTAACTGGC (End 26) - recA 156 F GTGGATCTATTGTATTAGATGAAGCTCTTG
(170-199) 206-361 - R
GCCAAAGTTCTGAAACATTAACTCCCAAAG (391-362) - ospA 261 F AATAGGTCTAATATTAGCCTTAATAGC (21-47)
48-308 - R
TTGATACTAATGTTTTGCCATCTTCTT (334-308) - rrl-rrf 197 F CTGCGAGTTCGCGGGAGAG (3' rrf)
197 - R
AAGCTCCTAGGCATTCACCATA (5' rrl)
15Table 1. Characteristics of the Borrelia
burgdorferi s.l. isolates used in step1.
- Isolate Species Geographic origin
Biologic origin Reference - B31T B. burgdorferi s.s. USA I.
scapularis Johnson et al., 1984 - IP1 B. burgdorferi s.s. France Human
CSF Boerlin et al., 1992 - 212 B. burgdorferi s.s. France I.
ricinus Postic et al., 1994 - VS461T B. afzelii Switzerland I.
ricinus Boerlin et al., 1992 - PGau B. afzelii Germany Human skin Wilske
et al., 1988 - BO23 B. afzelii Sweden Human skin Postic
et al., 1994 - 20047T B. garinii France I.
ricinus Valsangiacomo 1997 - PBi B. garinii Germany Human
CSF Preac-Mursic 1986 - NT29 B. garinii Japan I.
persulcatus Postic et al., 1994 - VS116T B. valaisiana Switzerland I.
ricinus Wang et al., 1997 - UK B. valaisiana U. Kingdom I.
ricinus Wang et al., 1997 - PotiB2T B. lusitaniae Portugal I.
ricinus Le Fleche et al., 1997 - PotiB1 B. lusitaniae Portugal I.
ricinus Le Fleche et al., 1997 - PC-Eq17T B. spielmanii France I.
ricinus Richter et al., 2004 - PC-Eq2/1 B. spielmanii France I.
ricinus Richter et al., 2004 - PC-Eq2r B. spielmanii France I.
ricinus Richter et al., 2004 - A14S B. spielmanii Netherlands Human
skin Wang et al., 1999
16(No Transcript)
17(No Transcript)
18(No Transcript)
19(No Transcript)
20-
- Delineation of Borrelia burgdorferi sensu lato
species - by multilocus sequence analysis
- and confirmation of the delineation of Borrelia
spielmanii - Dania Richter, Danièle Postic, Natacha Sertour,
Ian Livey, - Franz-Rainer Matuschka, and Guy Baranton
-
- IJSEM Papers in Press, published online 9
December 2005 - lthttp//ijs.sgmjournals.org/misc/pip.shtml
21Table 3 Characteristics of the isolates used in
step 2
- Isolate Species Geo. origin Biologic
origin Reference - B31T B. bor. ss USA I. scapularis Johnson
IJSB 1984 - 297 B. bor. ss USA Human CSF Steere NEJM 1983
- Sh2-82 B. bor. ss USA I. scapularis Schwann
II 1988 - 21123 B. and. New York I. dentatus Postic IJSB
1994 - 21133 B. and. New York I. dentatus Postic IJSB
1 - 19952 B. and. New York I. dentatus Postic IJSB
1994 - DN127 B. bis. California I. pacificus Bissett
JCM 1987 - CA55 B. bis. California I. neotomae Postic
IJSB 1994 - CA128 B. bis. California I. neotomae Brown
Science 1992 - CA2 B. sp. California I. neotomae Brown Lane
Science 1992 - CA8 B. sp. California I. pacificus Brown Lane
Science 1992 - CA13 B. sp. California I. neotomae Schwann JCM
1993 - CA28 B. sp. California I. pacificus Brown Lane
Science 1992 - CA29 B. sp. California I. pacificus Brown Lane
Science 1992
22(No Transcript)
23(No Transcript)
24(No Transcript)
25(No Transcript)
26Table 4 Characteristics of the additional
isolates used in step 3
- Isolate Species Geographic origin Biologic
origin Reference - M7 B. val. Netherlands I. ricinus Wang
Res Mic 2000 - Am501 B. val. Japan I. persulcatus
Masuzawa 1996 - NE49 B. sp. Switzerland I. ricinus
Postic JCM 1994 - 5LM218 B. sp. France I. ricinus
unpublished - Z41493 B. sp. Germany I. ricinus Postic
JCM 1994 - Z41293 B. sp. Germany I. ricinus Postic
JCM 1994 - Z51094 B. sp. Germany I. ricinus Postic
JCM 1994 - Z52794 B. sp. Germany I. ricinus Postic
JCM 1994 - Z57394 B. sp. Germany I. ricinus Postic
JCM 1994
27(No Transcript)
28(No Transcript)
29Conclusion 1
-
- Validation of both MLSA method in taxonomy and
B. spielmanii (IJSEM in press). - Delineation of 3 additional genomospecies in the
USA. - Confirmation of 2 geographical clusters of B.
burgdorferi s. l. in Old and New Worlds
30Conclusion 2
-
- European B. valaisiana does constitute a
monophyletic species. - Delineation of a 4th genomospecies mainly
comprising european isolates clustering as does
B. burgdorferi s. s. with North American species. - Outgroup geographical position of B. lusitaniae.