SARS

1
SARS
Brian J Ward MDCM McGill Division of Infectious
Diseases
2
Epidemic - World
Severe Acute respiratory Syndrome (SARS)
Parry J . BMJ 2003 Apr 19326(7394)839 SARS
shows no sign of coming under control.

3
Epidemic - World II
Severe Acute respiratory Syndrome (SARS)
4
Epidemic - World III
Severe Acute respiratory Syndrome (SARS)
5
Epidemic - Canada
Severe Acute respiratory Syndrome (SARS)
6
Severe Acute Respiratory Syndrome (SARS)

Chronology of Events
Nov 27, 2002 Mainland China - severe flu
noted Nov 02 - Feb 03 Cases appearing in
Guangdong province No official reports until
Feb 2003 Feb 02, 2003 First HC posting
(FluWatch) Acute respiratory syndrome Feb 11,
2003 Guangdong Dept Health - unknown
virus 305 cases 5 deaths Feb 13-23,
2003 Elderly TO couple in Metropole
Hotel Woman dies March 5, 2003 (ON1) Feb 23,
2003 Hanoi outbreaks - index is American 20
HCW develop symptoms Feb 24, 2003 Son of TO
woman admitted (ON2)
7
Chronology of Events (cont)
Feb 28, 2003 Hanoi - SARS identified by Dr C
Urbani Feb 12-Mar 2, 2003 Recognition of
Metropole Hotel outbreak Prince of Wales Hosp
(HK) outbreak in HCW Mar 3, 2003 Daughter of ON1
develops symptoms Mar 5, 2003 Wife of ON2
develops symptoms Mar 6, 2003 BC resident
(stayed at Metropole) admitted Mar 7,
2003 Second son of ON1 develops symptoms Mar 9,
2003 MD who cared for ON1-3 now sick Mar 12,
2003 70 HCW at PoW Hospital (HK) sick Mar 17,
2003 WHO mobilizes 11 labs in 10 countries Ma
18, 2003 German ID - metapneumovirus (MPV) by
EM Mar 20, 2003 53 cases admitted to PoW
Hospital (HK) Mar 21, 2003 NML finds MPV in 6/8
cases Mar 23, 2003 Scarborough Grace closes Mar
25, 2003 Metropole records - 168 Canadians at
risk Mar 27, 2003 HK finds coronavirus - CDC
confirms Mar 29, 2003 HK chief MO hospitalized,
Dr Urbani dies Apr 3, 2003 WHO team gets
permission to enter China Apr 7, 2003 Amoy
Gardens - entire complex in quarantine

8
Chronology of Events (cont II)
Apr 9, 2003 Travel advisories - increased
restrictions Apr 11, 2003 NML finds coronavirus
proteins by TMS Apr 12, 2003 Michael Smith
Genome Ctr - SARS genome Apr 14, 2003 Singapore
reports 80 decrease air traffic Apr 15,
2003 Questions raised wrt ribavirin (HK Rx) Apr
16, 2003 WHO announces new pathogen Apr 17,
2003 Risk/benefit warning wrt ribavirin Apr 19,
2003 WHO announces droplet spread TO cases
in HCW despite protective gear Apr 20,
2003 Sunnybrook trauma/ICU closes Apr 21,
2003 Finally - Chinese govt official
recognition Apr 22, 2003 CDC announces SARS can
survive 24 hours CDC announces travel alert to
TO China reports SARS in poor, inland
sites Apr 23, 2003 WHO includes TO in travel
advisory Apr 30,2003 CDN national meeting in TO
re SARS May 1, 2003 Nature - ribavirin
dangerous

9
Chronology of Events (cont)
Feb 28, 2003 Hanoi - SARS identified by Dr C
Urbani Feb 12-Mar 2, 2003 Recognition of
Metropole Hotel outbreak Prince of Wales Hosp
(HK) outbreak in HCW Mar 3, 2003 Daughter of ON1
develops symptoms Mar 5, 2003 Wife of ON2
develops symptoms Mar 6, 2003 BC resident
(stayed at Metropole) admitted Mar 7,
2003 Second son of ON1 develops symptoms Mar 9,
2003 MD who cared for ON1-3 now sick Mar 12,
2003 70 HCW at PoW Hospital (HK) sick Mar 17,
2003 WHO mobilizes 11 labs in 10 countries Ma
18, 2003 German ID - metapneumovirus (MPV) by
EM Mar 20, 2003 53 cases admitted to PoW
Hospital (HK) Mar 21, 2003 NML finds MPV in 6/8
cases Mar 23, 2003 Scarborough Grace closes Mar
25, 2003 Metropole records - 168 Canadians at
risk Mar 27, 2003 HK finds coronavirus - CDC
confirms Mar 29, 2003 HK chief MO hospitalized,
Dr Urbani dies Apr 3, 2003 WHO team gets
permission to enter China Apr 7, 2003 Amoy
Gardens - entire complex in quarantine

Published online - Lancet Apr 8, 2003 Peiris JSM,
et al. Coronavirus as a possible cause of severe
acute respiratory syndrome. Lancet 20033611319
50 cases coronavirus isolated from
2/50 serology and/or PCR positive in 45/50
no coronavirus in controls
10
Epidemiology - Initial Data
Severe Acute respiratory Syndrome (SARS)
initial information limited due to Chinese
policies data from Hanoi, HK, Toronto, Taiwan
- HCW at markedly increased risk - barrier
precautions appeared to be effective - mask
(N95), gowns, gloves visors - quarantine
little evidence of airborne transmission
droplet transmission suspected nothing known
about environment nothing known about
infectiousness - very sick more infectious (?
superspreaders) - probably not infectious
before symptomatic
11
Epidemiology - Amoy Gardens
Severe Acute respiratory Syndrome (SARS)
Amoy Gardens Appartment Complex (Hong Kong)
131 cases of SARS (block E residents) 241
asymptomatic residents quarantined ariborne,
droplet, water, environmental (cockroaches), etc
12
There are only 3 certainties in life ...
Death Taxes
That rents have gone down at the Amoy
Gardens Apartment Complex
13
Etiology
Severe Acute respiratory Syndrome (SARS)
initial report (CDN NML) - metapneumovirus
(PCR) - 6 of first 8 cases - seen
occasionally by other laboratories -
metapneumovirus activity in Hong Kong report of
Chlamydia spp from Germany subsequent reports
by US CDC HK (EM) - morphologically
consistent with coronavirus - rapid
development of culture systems PCR -
confirmed presence of a coronavirus in
most (but not all) patients
14
Etiology - II
Severe Acute respiratory Syndrome (SARS)
CDN National Microbiology Laboratory -
coronavirus isolation or PCR positive
(respiratory)
75 50 25 0
SARS confirmed
SARS probable
Non-SARS
15
Etiology - III
Severe Acute respiratory Syndrome (SARS)
Various laboratories - Early isolation from
respiratory tract (50) - gt85 isolation from
feces later in infection - Shedding of virus for
? days after resolution Erasmus University -
two monkeys (Rhesus macaques) - intra-tracheal
Vero cell supernatant - 1/2 animals developed
viral pneumonia - ? satisfies Kochs
postulates - currently being replicated at
NML CDC among others - ? Animal model
for SARS
16
Coronaviridae - Virology
Severe Acute respiratory Syndrome (SARS)
enveloped, single-stranded sense RNA
viruses  largest RNA viruses (27-32 kb) 2
genera - coronavirus - torovirus 3
antigenic coronavirus groups difficult to
isolate - happiest on primary cells
genetically labile normally narrow host
tissue specificity replicate in cytoplasm

17
Coronaviridae - Virology II
Severe Acute respiratory Syndrome (SARS)
Group I HCoV-229E human human respiratory
coronavirus TGEV, PRCoV pig porcine
transmissible gastroenteritis virus CCoV dog can
ine respiratory coronavirus FECoV cat feline
enteric coronavirus FICoV cat feline infectious
peritonitis virus RbCoV rabbit rabbit
respiratory coronavirus Group II HCoV-)C43 human
human respiratory coronavirus MHV mouse murine
hepatitis virus SDAV rat sialodacryoadenitis
virus HEV pig porcine hemagglutinating
virus BCoV cow bovine respiratory
coronavirus TCoV turkey turkey respiratory
coronavirus Group III IBV chicken avian
bronchitis virus TCoV turkey turkey respiratory
coronavirus
18
Coronaviridae - Virology III
Severe Acute respiratory Syndrome (SARS)
3
66 of genome devoted to polymerase gene (2
overlapping ORFs) produce nested set of mRNAs
Spike, E and HE embedded in lipid bilayer
(surface proteins) M also embedded (3 loops
through bilayer) S binds to host cell receptor
induces fusion antibodies against S
neutralize virus HE only in some sero-group II
viruses HE has 30 homology to influenza C
hemagglutinin (HA)
19
Virology IV
Severe Acute respiratory Syndrome (SARS)
Peiris JSM et al. Lancet 2003
mutations spread evenly throughout genome NOT
an obvious recombination virus a new agent
20
Coronaviridae - Biology
Severe Acute respiratory Syndrome (SARS)
normally highly host- tissue-specific
likely that many mammals have coronavirues -
implications for search for SARS reservoir
species stability of coronaviruses? - BCoV
vaccine (1980s) still works - RNA virus (1
error/10,000 bases or 3 errors/replication) -
tissue culture passage (MHV) relatively few
mutations - antibody pressure many more
mutations recombination possible (in vitro and
in nature) - TGEV evolved to PRCoV in
Europe in 1980s - large deletion in S protein
gene - similarly FECoV evolved into FIPV
21
Coronaviridae - Biology II
Severe Acute respiratory Syndrome (SARS)
recombination accomplished by -
discontinuous transcription - polymerase
jumping
GGCAATTATATCGGACTTAGAACCGA
Genomic Virus B
ATTCCAGATTATCGATTAGCGGAT
Genomic Virus A
22
Coronaviridae - Immunity
Severe Acute respiratory Syndrome (SARS)
Adults have partial protection from
coronaviruses Vaccines have been developed for
other viruses Role of immune response in
disease unknown Timing of vaccine
development effort If virus has just jumped
to man - expect rapid mutation to adapt to
human host - mutations could go in any
direction less pathogenic more
pathogenic different pathogenesis
23
Clinical Disease
Severe Acute respiratory Syndrome (SARS)
Case Definition measured temperature of
gt100.4F At least one finding of respiratory
disease - cough, SOB, difficulty breathing,
hypoxia, Xray) travel within 10 days of
symptom onset to at risk area - excluding
areas with secondary spread only to HCW
household contacts Contact within 10 days
of symptom onset with traveller
returned from risk area and respiratory
illness or case of suspected SARS
24
Clinical Features
Severe Acute respiratory Syndrome (SARS)
(first 10 cases) Fever 100
Nonproductive cough 100 Dyspnea 80
Malaise 70 Diarrhea 50 Chest
pain 30 Headache 30 Myalgias
20 Vomiting 10 Infiltrate on CXR
90 Oxygen saturation lt95 78
Poutanen SM et al. NEJM Apr 2003
25
Clinical Disease - Imaging
SARS
Nicolaou S et al. AJR Am J Roentgenol.
20031801247-9
55-year-old healthy man with history of recent
travel to Hong Kong.

AP showing extensive bilateral ground-glass
Opacities and poorly defined nodular pattern.
12 hours later
26
Mortality Rate?
Severe Acute respiratory Syndrome (SARS)
Dont Really Know estimates between 2-8
Canada among the highest estimates USA -
expect at least 3 deaths but 0/53 Need
serologic (or other) test for denominator
 Hospital-based outbreak (CDN) will increase
estimate Community-based (HK) or sporadic
(US) will lower  Rate in children may be
lower Even if 2 is true estimate
0.02 (5x10 ) 1x10 deaths
9
8
27
SARS Ribavirin
Severe Acute respiratory Syndrome (SARS)
Primum non nocere (first, do no harm)
second beware of 20/20 hindsight enormous
pressure to do something first bugs
metapneumovirus Chlaydia spp
ribavirin/antibiotics appropriate ?? of ARDS
made ribavirin-steroid combo logical
ribavirin acts vs coronaviruses only at toxic
doses  recommendation note to use - end April,
2003
28
Therapeutic Options
Severe Acute respiratory Syndrome (SARS)
progression variable symptoms pronounced
some have saddleback presentations -
apparent recovery - subsequent decline -
ARDS-like presentations ?? viral pneumonia vs
immune attack?? - no anti-viral know to be
effective - do not use ribavirin - steroids
probably a bad idea (unless ARDS likely)
supportive care
29
Epidemiology - Current Data
Severe Acute respiratory Syndrome (SARS)
coronavirus can live 24-48 hours on
objects  can live in feces for at least 2 days
(diarrhea - 4 days) most respiratory route but
mucosa possible ?? initial viremia with
widespread distribution both gut and
respiratory epithelium infected many subjects
shed virus from respiratory tissues virtually
all subjects shed virus in feces shedding
(after recovery) can be prolonged  ??
epidemiology in HIV-infected subjects
incubation period 2-10 days inoculum effect -
high dose, early bad disease some procedures
very high risk - intubation in conscious
patient
30
Current Status (World)
Severe Acute respiratory Syndrome (SARS)
SARS controlled everywhere except China
complicated blizzard of travel advisories -
new visa requirements - exclusions -
alerts vs advisories vs bans - all levels
of authority have made pronouncements China
now apparently more transparent  WHO actions
may paradoxically decrease compliance - but
they had no choice - only real criticism wrt
Canada was timing (ie slow) most experts
believe SARS now endemic in China
31
Current Status (China)
Severe Acute respiratory Syndrome (SARS)
massive increases in SARS cases - Beijing
37 cases 10 days ago - Beijing almost 3,000
cases (May 6, 2003) rapid spread (or
acknowledgement of presence) - rural
provinces (migrant workers escaping Beijing)
- south to north - coast to Mongolia WHO
teams now in Guangdong, Beijing and northern
province (? Herxe) due to explosive growth of
case reports widespread panic, rural
communities establishing own quarantine,
killing pets
32
Current Status (Canada)
Severe Acute respiratory Syndrome (SARS)
SARS controlled in BC Toronto  First SARS
meeting (April 30 - May 1, 2003) Major
recommendations - create National Public
Health Authority - create National Public
Health capacity (CDC-like) - need resources to
be mobilized faster than CIHR - human
resources pitifully limited - need trainees at
all levels - need National (research) SARS
think tank - research priorities organized
immediate medium term long-term vaccine
33
Current Status (Science)
Severe Acute respiratory Syndrome (SARS)
coronavirus likely to be etiologic agent
knowing reservoir would be helpful need (small)
animal model need rapid diagnostic test (extent
of disease, mortality) - classical EIA -
antigen-detection ?? immunity
immunopathogenesis ?? - antibodies are
produced can neutralize (others) - role of
cell-mediated immunity (help or harm) -
immunologic memory (vaccines possible for
others) - above will dictate vaccine
development novel anti-virals possible -
polymerase can be targeted
34
Current Status (McGill)
Severe Acute respiratory Syndrome (SARS)
RVH designated as SARS site (if needed)  Has
the most negative-pressure rooms  SARS team
- infection control - infectious diseases
- respiratory medicine Clinics encouraged
to screen by phone questions  Possible cases
sent to ER at RVH (or other sites)  Barrier
precautions (immediate)
environmental decontamination  Immediate
involvement of public health