Cloning Simulation Project

1
Cloning Simulation Project

• Cloning of Retro-nitroreductase Towards the
  Degradation of RDX

By Group G
2
Group G

• Noorshazilawati bt. Mohd. Rashid 70954
• Nor Adlin bt. Md. Yusoff 70955
• Norashikin bt. Jamil 70956
• Margaret Ting Siew Wei 71042
• Nurazira bt. Azizan 71057
• Rina Haryani bt. Osman Basah 71058
• Rosaniza bt. Kamarudin 71059
• Helmi bin Mohd. Hadi Pritam 72600

3
Objectives

• The objectives of the cloning simulation
  project
• To understand the concept of molecular biology
  and biotechnology introduced in the GTB 204/3
  Molecular Biology Technique
• To obtain experiences in DNA cloning
  theoretically
• To clone the retro-nitroreductase gene
• To learn how to work as a team

4
Introduction

• What is retro-nitroreductase
• It is an enzyme encoded by the retro-nitroreductas
  e gene found in Enterobacter cloacae
• It catalyzes the pyridine nucleotide-dependent
  four-electron reduction of a variety of
  nitroaromatic compounds
• Royal Demolition Explosive (RDX) or 1, 3,
  5-trinitro-1, 3, 5-triazine
• TNT or 2, 4, 6-trinitrotoluena
• Tetryl or 2,4, 6-trinitrophenyl-N-metilnitramine
• Pentryl or 2, 4, 6-trinitrophenyl-N-nitroaminoetil
  nitrate
• Other bacteria also produced nitroreductase but
  we chose nitroreductase enzyme that is produced
  by Enterobacter cloacae because it has catalytic
  activity that is much higher than other bacteria.
• Enterobacter cloacae also encoded for other
  proteins but they are pathogenic.
• We clone this gene into E. coli because
  Enterobacter cloacae itself encoded many proteins
  that are pathogenic

5
Royal Demolition Explosive (RDX)

• Royal Demolition Explosive or RDX (hexahydro-1,
  3, 5-trinitro-1,3,5-triazine) is a powerful,
  highly energetic chemical whose wide use in
  various military and civilian applications
• It has cyclic aromatic structure
• Cyclic nitramine explosives have been proven to
  be toxic
• The toxicity of cyclic nitramines necessitates
  that contaminated soil and groundwater be
  remediated, preferably biologically

6
Degradation of RDX

• RDX is degraded both aerobically and
  anaerobically by microorganisms
• Hexahydro-1,3,5-trinitro-1,3,5-triazine
• Enterobacter cloacae retro-nitroreductase
• 
  
  
  
  
  Type 1 nitroreductase
• Hexahydro-1-nitroso-3,5-dinitro-1,3,5-triazine
• Type 1 nitroreductase
• Hexahydro-1,3-dinitroso-5-nitro-1,3,5-triazine
• Type 1 nitroreductase
• Hexahydro-1,3,5-trinitroso-1,3,5-triazine
• C
• Carbon dioxide nitrous oxide

7
Methodology
8
(No Transcript)
9
(No Transcript)
10
Properties of Retro-nitroreductase Gene

• Gene Sequence
• Open Reading Frame
• Molecular Weight
• Restriction Enzyme Site

11
Gene Sequence

• We obtained the gene sequence of
  retro-nitroreductase gene through
  www.ncbi.nlm.nih.gov
• Accession AY013713
• BASE COUNT ORIGIN 162 a 181 c 185 g
  126 t
• 1 atggatatca tttccgttgc cctgaaacgc cactccacca
  aggcgtttga cccaagcaag
• 61 aaactgaccg ctgaagaagc ggagaagatc aaaaccctgc
  tgcagtacag cccgtccagc
• 121 acgaactccc agccgtggca ttttattatt gccagcactg
  aggaaggtaa agcgcgcgtg
• 181 gcaaaatctg cggcaggcac ttacgtgttc aacgaacgca
  aaatgatgga cgcctctcat
• 241 gtggtagtgt tctgcgcgaa aaccgccatg gacgatgcgt
  ggcttgagcg cgtcgtggat
• 301 caggaagagg ccgacggtcg cttcaacacc ccagaagcaa
  aagcggcgaa tcacaaaggt
• 361 cgctgctatt tcgccgacat gcaccgcgtg gatctgaaag
  atgacgacca gtggatggcg

12
Open Reading Frame

• We analyzed the Open Reading Frame (ORF) of the
  gene through www.ncbi.nlm.nih.gov/go
  rf/gorf.html
• Open Reading Frame (ORF) is a DNA sequence
  containing series of codons, which can be
  translatable into protein.
• ORF starts with a start codon (ATG or GTG),
  contains the actual sequence that code for a
  protein/polypeptide and ends with a stop codon
  (TGA, TAG or TAA).
• From ORF analysis, we know that we needed the
  whole gene sequence for the expression of
  retro-nitroreductase. So for that reason, the 1
  frame that include the whole frame from base pair
  1 to base pair 653 that has the length of 654
  base pair is selected.

13
Open Reading Frame (ORF) Analysis

• 1 atg gat atc att tcc gtt gcc ctg aaa cgc cac
  tcc acc aag gcg
• M D I I S V A L K R H
  S T K A
• 46 ttt gac cca agc aag aaa ctg acc gct gaa gaa
  gcg gag aag atc
• F D P S K K L T A E E
  A E K I
• 91 aaa acc ctg ctg cag tac agc ccg tcc agc acg
  aac tcc cag ccg
• K T L L Q Y S P S S T
  N S Q P
• 136 tgg cat ttt att att gcc agc act gag gaa ggt
  aaa gcg cgc gtg
• W H F I I A S T E E G
  K A R V
• 181 gca aaa tct gcg gca ggc act tac gtg ttc aac
  gaa cgc aaa atg
• A K S A A G T Y V F N
  E R K M
• 226 atg gac gcc tct cat gtg gta gtg ttc tgc gcg
  aaa acc gcc atg
• M D A S H V V V F C A
  K T A M
• 271 gac gat gcg tgg ctt gag cgc gtc gtg gat cag
  gaa gag gcc gac
• D D A W L E R V V D Q
  E E A D
• 316 ggt cgc ttc aac acc cca gaa gca aaa gcg gcg
  aat cac aaa ggt
• G R F N T P E A K A A
  N H K G
• 361 cgc tgc tat ttc gcc gac atg cac cgc gtg gat
  ctg aaa gat gac
• R C Y F A D M H R V D
  L K D D
• 406 gac cag tgg atg gcg aaa cag gtt tac ctc aac
  gtc ggt aac ttc

14
Molecular weight

• We determined the molecular weight of the protein
  by using BioEdit Software
• Protein retro-nitroreductase protein
• Length 217 amino acids
• Molecular Weight 23.990 kD

15
Restriction Enzyme Site

• Restriction enzyme analysis is important in
  knowing which restriction enzyme that cut or
  uncut the gene of interest.
• Since we want to use the whole gene sequence and
  we want to add restriction sites to the gene, it
  is important that we know which enzyme that do
  not cut the sequence.
• We used the BioEdit Software to analyze the
  restriction enzyme site in the gene sequence.

16
Restriction enzymes analysis

• Enzymes that do not cut
• AarI, AatII, AccI, AceIII, AclI, AflII, AhdI,
  AloI, AlwNI, ApaI, ApaLI, ApoI, AscI, AvaI,
  AvrII, BaeI, BaeI, BamHI, BanI, BanII, BbsI,
  BbvCI, BcgI, BcgI, BciVI, BclI, BglI, BglII,
  BmgI, BmrI, BplI, BplI, BpmI, Bpu10I, BsaI,
  BsaBI, BsaWI, BsaXI, BseRI, BseSI, BsgI, BsmI,
  BsmAI, BsmBI, BspEI, BspLU11I, BspMI, BsrBI,
  BsrDI, BsrFI, BsrGI, BssSI, BstEII, BstZ17I,
  Bsu36I, BtrI, BtsI, ClaI, DraI, DrdI, DrdII,
  EagI, EciI, Eco47III, EcoNI, EcoO109I, EcoRI,
  FauI, FseI, FspI, HaeII, HaeIV, HgiEII, Hin4I,
  HincII, HindIII, HpaI, KpnI, MluI, MscI, MunI,
  NarI, NdeI, NgoAIV, NheI, NotI, NruI, NsiI, NspV,
  PacI, Pfl1108I, PinAI, PleI, PmeI, PmlI, PpiI,
  PshAI, PsiI, Psp5II, PvuI, PvuII, RcaI, RleAI,
  RsrII, SacI, SacII, SalI, SanDI, SapI, SbfI,
  ScaI, SexAI, SfiI, SgfI, SgrAI, SmaI, SnaBI,
  SpeI, SphI, SrfI, Sse8647I, SspI, StuI, SunI,
  SwaI, TaqII, TaqII, Tth111I, VspI, XbaI, XhoI

17
BLAST Analysis and Multiple DNA Sequence Alignment

• BLAST Analysis
• BLAST (Basic Local Alignment Search Tool) is a
  set of similarity search programs designed to
  explore all of the available sequence databases
  regardless of whether the query is protein or DNA
  
• The purpose of BLAST Analysis is to make sure
  that the gene sequence that we found is the exact
  gene sequence of the gene of interest. BLAST will
  compare the known unit of new (novel) gene
  sequences with the gene sequences in the database
  to check for an error
• We analyzed the sequence based on DNA level and
  not on amino acid level because there are other
  codons from other bacteria that encode for
  nitroreductase, but those similarities are minor
  and not 100

18
BLAST Analysis

• RID 1061006069-08762-25390
• From the result, we found that our gene of
  interest is exactly retro-nitroreductase gene.
• From the result also, we found that there are
  other gene sequences that code for nitroreductase
  but those similarities are minor and not 100.
• Below are the lists of bacteria and synthetic
  product that produce the same product (i.e.
  nitroreductase) but are different in gene coding
  sequences and have different percentages in
  similarity.
• M68308 Enterobacter cloacae oxygen-insensitive
  NAD(P)H nitroreductase (nfsI)
• X12750 Salmonella typhimurium gene for
  nitroreductase
• D25414 Escherichia coli gene for
  oxygen- insensitive NAD(P)H nitroreductase
• UO7860 Escherichia coli nitroreductase (nfnB)
  gene
• AF394661 Synthetic construct glutathione-S- tra
  nsferase-nitroreductase B fusion protein gene

19
Multiple DNA Sequence Alignment

• Multiple DNA Sequence Alignment
• Clustal W is a general purpose multiple sequence
  alignment program for DNA or proteins
• It calculates the best match for the selected
  sequences, and lines them up so that the
  identities, similarities and differences can be
  seen
• For multiple DNA sequence alignment, we have
  selected gene sequences of a certain region
  (local alignment) of few bacteria or organisms
  that produce the similar enzyme like
  retro-nitroreductase. The sequences are
• AY013713 Enterobacter cloacae retro-nitroreductase
  gene
• M68308 Enterobacter cloacae oxygen-insensitive
  NAD(P)H nitroreductase (nfsi) gene
• X12750 Salmonella typhimurium gene for
  nitroreductase
• D25414 Escherichia coli gene for
  oxygen-insensitive NAD(P)H nitroreductase
• UO7860 Escherichia coli nitroreductase (nfnB)
  gene
• AF394661 Synthetic construct glutathione-S-transfe
  rase- nitroreductase B fusion protein gene

20
Multiple DNA Sequence Alignment

• CLUSTAL W (1.82) multiple sequence alignment
• U07860 --------------------------------------
  ----------------------
• D25414 ATGGATATCATTTCTGTCGCCTTAAAGCGTCATTCCAC
  TAAGGCATTTGATGCCAGCAAA 60
• AF394661 ---GATATCATTTCTGTCGCCTTAAAGCGTCATTCCAC
  TAAGGCATTTGATGCCAGCAAA 57
• AY013713 ATGGATATCATTTCCGTTGCCCTGAAACGCCACTCCAC
  CAAGGCGTTTGACCCAAGCAAG 60
• M63808 ATGGATATCATTTCTGTCGCCCTGAAACGCCACTCTAC
  CAAGGCGTTCGACGCAAGCAAA 60
• X17250 ATGGATATCGTTTCTGTCGCCTTACAGCGCTACTCCAC
  TAAGGCGTTCGATCCCAGCAAA 60
• U07860 -----TACCCCGGAACAGGCCGAGCAGATCAAAACGCTA
  CTGCAATACAGCCCATCCAGC 55
• D25414 AAACTTACCCCGGAACAGGCCGAGCAGATCAAAACGCTA
  CTGCAATACAGCCCATCCAGC 120
• AF394661 AAACTTACCCCGGAACAGGCCGAGCAGATCAAAACGCTA
  CTGCAATACAGCCCATCCAGC 117
• AY013713 AAACTGACCGCTGAAGAAGCGGAGAAGATCAAAACCCTG
  CTGCAGTACAGCCCGTCCAGC 120
• M63808 AAACTGACCGCGGAAGAAGCGGAAAAAATCAAAACCCTG
  CTGCAGTACAGCCCGTCCAGC 120
• X17250 AAACTGACCGCCGAAGAAGCGGATAAAATAAAAACACTA
  CTACAGTACAGCCCCTCCAGC 120
• 
  

21
Properties of expression vector

• Choosing suitable expression vector
• We have decided to use pTrcHis B
• The vector uses the trc promoter for high-level
  regulated expression of recombinant protein in E.
  coli.
• We chose to use pTrcHis B because pTrcHis B offer
  the following features
• MSC for EcoRI and Hind III
• Ampicillin resistant marker
• Enterokinase cleavage site for removal of fusion
  tag
• LacO operator and lacIq repressor gene for
  transcriptional regulation in any E.coli strain.
• 6xHis tag for rapid purification.
• N-terminal Xpress epitope for easy detection
  with an Anti-Xpress Antibody.

22
pTrcHis B map
23
pTrcHis B map

• pTrcHis B - 4404 nucleotides
• trc promoter bases 191-221
• lac operator bases 228-248
• rrnB anti-termination sequences bases 264-333
• T7 gene 10 translational enhancer bases
  346-354
• Ribosome binding site bases 370-374
• Mini-cistron bases 383-409
• Polyhistidine and enterokinase cleavage site
  bases 425-504
• Xpress epitope bases 482-505
• Multiple cloning site bases 515-554
• rrnB transcriptional termination sequence bases
  637-794
• Ampicillin resistance ORF bases 1074-1934
• pBR322 origin bases 2079-2752
• lac Iq ORF bases 3281-4365

24
Primer Design For Polymerase Chain Reaction (PCR)
Amplification of Retro-nitroreductase Gene and
Recombinant Clone Screening

• Primers
• Typically short,single-stranded oligonucleotides
• Complementary to outer regions of known sequence
• Ranging from 18-30 bases
• Have 35-65 CG content
• Two primers needed, forward primer and reverse
  primer
• Forward primer should not be complementary with
  reverse primer

25
Primer Design

• Primer design
• Forward primer
• 5ATGAATTCATGGATATCATTTCCGTTG3
• Reverse primer
• 5ATAAGCTTTCAGCACTCGGTCACAATCG3
• NOTE
• Primers are designed with EcoR I restriction site
  at 5end of forward primer and Hind III
  restriction site at 5end of reverse primer

26
Primer Annealing Temperature

• Primer annealing temperature
• Forward primer 5 ATGAATTCATGGATATCATTTCCGTTGC
  3
• A 4, T 8, C 4, G 4
• Tm (AT) 2 (GC) 4
• (48) 2 (44) 4
• (12) 2 (8) 4
• 56C
• Annealing temperature 56C - 2C 54C
• Reverse primer 5 ATAAGCTTTCAGCACTCGGTCACAATCG
  3
• A 5, T 4, C 7, G 4
• Tm (AT)2 (GC)4
• (54)2 (47)4
• (9)2 (11)4
• 62C
• Annealing temperature 62C - 2C 60C
• We compared the forward and reverse primer
  annealing temperature and used the lowest
  annealing temperature, 54C for PCR

27
Amplification of Retro-nitroreductase Gene from
Enterobacter cloacae by Polymerase Chain
Reaction (PCR)

• We use PCR to amplify our gene of interest.
• PCR is an in vitro technique for the
  amplification of a region DNA that lies between
  two known sequence regions by using
  oligonucleotide primers.
• Taq polymerase adds A at the 3 ends at each of
  the sequences. This would be useful for cloning
  in T/A cloning vectors such as TOPO, however this
  feature is not used in our project for we are
  cloning the PCR product directly into PtrcHis B
  using the EcoRI and Hind III site.
• Steps of PCR
• Template denaturation
• Primer annealing
• Primer extension
• After amplification, we run agarose gel
  electrophoresis to ensure that the gene is
  well-amplified

28
Digestion of Retro-nitroreductase gene by EcoR I
and Hind III

• We chose EcoR I and Hind III restriction enzyme
  because these restriction enzymes do not cut the
  sequences.
• Since we want the whole gene sequence that code
  for the retro-nitroreductase, it is important
  that the restriction enzyme does not cut the
  sequence.
• We chose EcoR I and Hind III because these
  restriction enzymes digest the DNA to give
  cohesive or sticky ends.
• Sticky ends are more effectively joined than
  blunt ends because the complementary of the
  overhangs allows hydrogen bonds to form and
  stabilize the two molecules before ligase can
  act.

29
Digestion of pTrcHis B by EcoR I and Hind III

• The pTRcHis B expression vector has a multiple
  cloning site for EcoR I and Hind III. This is
  important because our gene of interest has been
  digested with EcoR I and Hind III. If the
  expression vector is not digested with the same
  restriction enzyme, the gene may not recognize
  its recognition sequence and thus cannot be
  ligated.

30
Ligation of Retro-nitroreductase gene into
pTrcHis B by T4 DNA ligase

• In this step, the retro-nitroreductase gene is
  cloned into the pTrcHis B.
• We chose T4 DNA ligase as enzymes for ligation
  because it is cheap and more commercially
  available
• T4 DNA ligase can ligate blunt and sticky ends.
• The pTrcHis B expression vector is treated with
  the Shrimp Alkaline Phospatase (SAP) solution.
• Shrimp alkaline phosphatase (SAP) catalyzes the
  dephosphorylation of 5-termini phosphates from
  DNA and RNA.
• Alkaline phosphatase is an enzyme that can modify
  DNA molecules by removing the phosphate group at
  the 5' terminus of a DNA molecule.
• Removal of the phosphate group from 5' terminus
  will prevent religation and recircularization of
  linearised cloning vehicle DNA during cloning
  work.
• We chose to use SAP because it is more efficient
  and convenient.

31
Ligation of Retro-nitroreductase gene into
pTrcHis B by T4 DNA ligase

• Treatment with T4 DNA ligase to form phosphate
  bond
• T4 DNA ligase requires ATP for the reaction
• Incubation at optimum temperature - 16C for 12
  hours

gene
pTrcHis and inserted gene
pTrcHis
T4 DNA ligase
32
Ligation of Retro-nitroreductase Gene into
pTrcHis B by T4 DNA ligase

• Efficiency of ligation depends on
• The absolute DNA concentration
• The concentration should be high enough to ensure
  that intermolecular ligation is favored over
  self-ligation but not so high as to cause
  extensive formation of oligomeric molecules.
• Ratio between vector and insert DNA
• The maximum yield of the right recombinants is
  usually obtained using a molar ratio of insert to
  vector DNA of approx. 2. If the concentration of
  insert DNA is substantially lower than that of
  the vector, the ligation efficiency becomes very
  low.
• Cloning strategy
• Higher yields of the right recombinant are
  obtained when the vector and insert have been
  prepared using two restriction enzymes and the
  digested vector has been gel-purified before the
  ligation reaction

33
Ligation of Retro-nitroreductase Gene into
pTrcHis B By T4 DNA ligase
34
Transformation Of Recombinant Clone onto TOP10
Escherichia coli

• Making the bacterial cell competent, then
  introduce the plasmid Dna by transformation
  Competence ability of bacteria to take foreign
  DNA
• Uptake of DNA by E. coli (Invitrogen
  corporation).
• E. Coli - Easy to grow observed
• - can control the spread of the cloned DNA
• - only strain which does not grow outside the
  lab
• For this cloning simulation project, we have
  decided to use TOP10 E.coli as a host.
• TOP10 E. coli offers the following feature
• TOP10 cells are provided at transformation
  efficiencies of 1106cfu/µg supercoiled DNA and
  are ideal for high efficiency cloning and plasmid
  propagation.
• TOP10 cells allow stable replication of high copy
  number plasmid.
• Reduction of homologous recombinant of
  transformed plasmid (recA)
• Blue or white screening via ß-galactosidase
  a-complemantation (lacZ?M15)
• Increased quality of plasmid DNA preparation
  (endA)
• No cleavage of methylated DNA (mcrA, mcrCB, mrr)
• No host restriction of foreign DNA or no cleavage
  of unmethylated DNA (hsd)
• Calcium chloride method
• treating E. coli with ice-cold solution of
  Calcium chloride
• It is thought that this method produces pores in
  the bacteria cell membrane which allows DNA to
  pass through
• Heat shocking initiates transferring of DNA into
  the cell

35
Procedures for Transformation
36
Possibilities of Transformation
Genomic DNA

• Transformation

E. coli without plasmid
Genomic DNA
E. coli with plasmid
37
Screening of Recombinant Clone by Polymerase
Chain Reaction and Verification of Successful
Cloning

• The present of retro-nitroreductase gene in
  pTrcHis B expression vector can be confirmed by
  polymerase chain reaction or PCR.
• To confirm the size and the orientation of the
  insert, screening with PCR will be confirmed
  using the pTrcHis B Forward primer and the
  reverse primer that was used to amplify the gene.

38
PCR Screening Strategy
39
Preparing Cell Lysate for Polymerase Chain
Reaction (PCR)

• We have selected four colonies from the patched
  plate.
• The colonies are labeled from 1 to 4
• Each of the colonies is removed with wire loop
  and is dissolved in each separate tubes
  containing distilled water.
• Mineral oil is added to the tube
• The tubes are boiled
• The tubes are spin
• The supernatant is taken as the lysate
• PCR is run using the supernatant as the template.

40
Verification of Successful Cloning
41
Expression of Retro-nitroreductase in TOP10
Escherichia coli

• The pTrcHIS B expression vector contains genes
  coding for antibiotic resistance, and when the
  culture is transferred to antibiotic agar plates,
  only the transformed cells are able to survive
  and colonize.
• These cells, carrying the recombinant plasmid,
  can then be cultured in liquid media. Because
  cloning vectors usually contain a lac operon to
  control gene expression, the protein is not
  immediately expressed.
• IPTG (Isopropyl-b-D-thiogalactoside) is
  introduced to the culture to induce the vectors'
  lac operons
• IPTG binds with the repressor inhibiting the
  repressor from binding to the gene so the
  transcription occurs.

42
(No Transcript)
43
Purification and Detection of 6XHis-tagged
Proteins

• Protein purification in the Xpress system is
  based on the remarkable affinity between 6xHis
  tag and divalent nickel cations which are
  immobilized on the ProBond Resin.
• To simplify the process of purification, the
  whole process is stated in below-
• 1)Cell lysate containing 6xHis-tagged protein is
  prepared.
• 2)Bind 6xhis-tagged protein onto ProBond column
  at ph 7.8
• 3)Wash the unbound protein or protein without the
  His tag with buffer.
• 4)Elute the 6xHis-tagged protein with either
  lowering buffer(pH4.0 or 6.0) or using 50-500mM
  imidazole
• 5)His-tagged protein is treated with a spesific
  enterokinase to cleave off the His-tagged
• 6)The recombinant protein is freed of the His-tag
  peptide by running it over the metal chelate
  column again.

44
Purification and Detection of 6His-tagged
Protein
45
COMMERCIAL VALUE

• To create a transgenic plant that encodes for the
  retro-nitroreductase.
• Can bioremediate the soil contaminate by RDX.
• So, this plant can survive in the bioterrorism
  war and industrial area.

46
COMMERCIAL VALUE

• Produce biosensors for chemical weapons and
  explosives detection
• For wide area detection.
• Use plant as a biosensors.
• To create a RDX - soluble fertilizers

47
Conclusion

• Finally, we manage to clone the Enterobacter
  cloacae retro-nitroreductase gene successfully
  and finish the report within a month. We hope
  that this product can be accepted widely for
  commercial use in concern to the environmental
  aspect.
• Through this cloning project, we have learned and
  experienced a lot of new things. As the benefit,
  we are now able to understand a lot on how the
  cloning is done.
• We achieved this by applying the theories and
  concepts that had been taught during lectures and
  practical into this cloning simulation project.
  By doing the cloning simulation project, we have
  learned the process in cloning the DNA. This
  process includes searching for the right gene,
  analyzing the gene sequence, choosing the
  appropriate expression vector, drawing the
  technique for cloning the gene and lastly
  choosing the right technique in screening the
  gene and purifying the proteins. We also learn
  how to search for genes in the GenBank, how to
  use the BioEdit software, to design primers and
  all the things that need to be done to complete
  this project. After all, even not much but we are
  really able to understand the basic concepts in
  molecular biology technique.
• We are also thankful and grateful to the
  advancement in computerized biotechnology and
  software that simplify our project. We manage to
  access the information regarding molecular
  biology easily and apply it by using certain
  software without much difficulty.
• In conclusion, this cloning simulation project is
  really useful in making students understand much
  and go through the overall concepts in order to
  complete the project.

48
References

• William Wu, 1997 , Methods In Gene Biotechnology,
  CRC Press LLC, United States of America
• Karp, G., 2002, Techniques in Cell and
  Molecular Biology, Cell and Molecular Biology
  Concept and Experiment, 3rd Edition, John Wiley
  Sons, New York, , Chapter 18, pg 781 783
• Tortora, J. G., Funke, R. B., and Case, C. L.,
  1989, Bacteria, Microbiology An Introduction,
  3rd Edition, The Benjamin/Cummings Publishing
  Company, Inc., California, Chapter 26, pg 267
• Cho, H., and Cronan, J., 1992, Escherichia coli
  Thioesterase I, Molecular Cloning and Sequencing
  of the Structural Gene and Identification as a
  Periplasmic Enzyme, Journal of Biological
  Chemistry, 268, no. 13 (1992) 9238-9245.
• Lee, Y., Chen, J., and Shaw, J., 1996, The
  Thioesterase I of Escherichia coli has
  Arylesterase Activity and Shows Stereospecificity
  for Protease Substrates, Biochemical and
  Biophysical Research Communications, 231 (1996)
  452-456.

49
References

• Sambrook, J., Fritsch, E. F., and Maniatis, T.,
  1989, Molecular Cloning A Laboratory Manual, 3rd
  Edition, New York Cold Spring Harbor Press
• Hawari J, Halasz A, Sheremata T, Beaudet S, Groom
  C, Paquet L, Rhofir C, Ampleman G, Thiboutot S,
  2000, Characteristization of Metabolites during
  biodegradation of Hexahydro-1,3,5-trinitro-1,3,5-t
  riazine with municipal anaerobic sludge,
  Biotechnology Research Institute, National
  Research Council of Canada, Montreal, Quebec
  H4P2R2, jalalhawari_at_nrc.ca
• Availablehttp//www.ncbi.nlm.nih.gov/entrez/quer
  y.fcgi?cmdRetrievedbPubMedlist_uids10831452d
  optAbstract
• Jeff Roberts and Prasad Kotharu,. July 15, 2002,
  Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX)
  (anaerobic) Pathway map, University of
  Minnessota, BBDMaster_at_mail.ahc.umn.edu
• Available http//umbbd.ahc.umn.edu/rdx2_map.html
  

50
References

• William, R. E., Rathbone, D. A., Moody, P. C.,
  Scrutton, N. S., Bruce, N.C., 2001, Degradation
  of Explosives by nitrate ester reductases,
  Institute of Biotech, University of Cambridge,
  Tennis Court Road, Cambridge CB2 IQT, U.K.
• Availablehttp//www.ncbi.nlm.nih.gov/entrez/quer
  y.fcgi?cmdRetrievedbPubMedlist_uids1157334d
  optAbstract
• Bergey, D. H. et al (1923), Bergey, D. H.,
  Harrison, F.C., Breed, R. S., Hammer, B. W., and
  Hubtoon, F. M., Bergeys Manual of Determinition
  Bacteriology, 1st Edition, 1923, The Williams and
  Wilkins Co., Baltimore, pp 1 - 442 (no PubMed
  record available)
• Lehmann, K. B, and Newmann, R., 1896, Lehmann, K.
  B. and Newmann, R., Atlas and Grundriss der
  Bakeriologie and Lehrbuch der speziellen
  bakteriologischen Diagnostik, 1st Edition, 1896,
  J. F. Lehmann, Munchen.

51
References

• Kitts, C. L., Green, C. E., Otley, R. A.,
  Alvarez, M, A., Unkefer, P. J., 2000, Type 2
  nitroreductases in soil enterobacteria reduce
  2,4,6-trinitrotoluene(TNT) and hexahydro-1,3,5-tri
  nitro-1,3,5-triazine (RDX), Environmental
  Biotechnology Institute, California Polytechnic
  State University, San Luis Obispo 93407, USA.,
  ckitts_at_calpoly.edu
• Availablehttp//www.ncbi.nlm.nih.gov/entrez/quer
  y.fcgi?cmdRetrivedbPubMedlist_uids10749541do
  ptAbstract
• Ruth Irwin, 2002, Information system for
  Biotechnology, 207 Engel Hall, Virginia
  Polytechnic, Institute and State University,
  Blacksburg, VA 24061. isb_at_vt.edu
• Available www.isb.vt.edu/news/2002/news02.Jan.ht
  ml,
• Koder RL, Oyedele O, Miller AF, 2001 Oct 3
  Retro- nitroreductase, a putative evolutionary
  precursor to Enterobacter cloacae strain 96-3
  nitroredutase. Department of Chemistry, The
  University of Kentucky, Lexington 40506-0055,
  USA, (5) 747-55. PMID 11761325 PubMed-indexed
  for MEDLINE, Availablehttp//www.ncbi.nlm.nih
  .gov/entrez/query.fcgi?cmdRetrievedbPubMedlist
  _uids11761325doptAbstract

52
References

• Castellani, A., and Chalmer, A. J., 1919, Manual
  of Tropical Medicine, 3rd Edition, 1919, William
  Wood and Co., New York (no PubMed record
  available)
• Hormaeche, E., and Edwards, P.R., 1958,
  Observations on the Genus Aerobacter with a
  Description of Two Species, International
  Bulletin Bacteriol Nomenclature Taxonomy 1958, 8
  111-115 (no PubMed record available)
• Jordan, E. O., 1890, A Report on Certain Species
  of Bacteria Observed in Sewage, In W. T
  Sedgewick (ed), A Report of the Biological Work
  of the Lawrence Experiment Station, Including an
  Account of Methods Employed and Results Obtained
  in the Microscopial and Bacteriological
  Investigation of Sewage and Water, Report on
  Water Supply and Sewage (Part II), The Report of
  the Massachusettes Board of Health, 1980, pp 821
  844

53

• http//www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd
  Retrievedbnucleotidelist_uids12232329doptGen
  Bank
• http//www.invitrogen.com./content.cfm?pageid1se
  archcatAllsearch_termpTrcHis20B, Catalog
  Number V36020
• Promega Life Science Catalog 2003
• Invitrogen Catalog 1999
• Stratagene Catalog