Topic 17. Lecture 26. Evolution of Populations and Ecosystems-I

1
Topic 17. Lecture 26. Evolution of Populations
and Ecosystems-I
Last time, we considered whatever little is
understood regarding Macroevolution at the
functional level of molecules, cells, and
multicellular organisms. Now we are moving at
the upper levels of populations and ecosystems.
At these levels, organisms are treated as
individuals, ignoring their internal complexity
and taking into account only their external
features that characterize them as members of
populations. Naturally, the key problems of
evolution cannot be addressed in this way - we
will not attempt to understand complex
adaptations by considering individuals. Still,
many important and fascinating issues can be
studied at the level of populations, including
evolution of sex, aging , and interactive
behavior. Within its domain of applicability,
treating organisms as individuals, and
considering only simple external phenotypes, is a
very productive approach to Macroevolution.
Organism Individual
ACGATCGACGACGATCGATCGACGATCGA
2
What questions can be addressed by considering
Macroevolution of simple phenotypes? Independen
tly evolving individuals Gene
transmission 1. Phenotypic plasticity
1. Mutation
2. Non-interactive behavior
2. Maintenance of sex 3. Semelparity
and iteroparity 3.
Crossing-over 4. Clutch size
4. Systems of
mating 5. Dormancy
5. Origin of sex
6. Aging
6. Outcomes of genetic conflicts
Interactions between individuals
Complex population-level phenomena
1. Warning coloration
1. Multicellularity and coloniality
2. Dispersal
2. Anisogamy and sex allocation
3. Aggression
3. Mate choice 4.
Cooperation and altruism 4.
Female preferences and male displays

5. Conflicts between gametes and
sexes
6. Conflicts
between relatives
7.
Eusociality For some of these questions,
surprisingly definite answers have been obtained.
For other questions, there are no definite
answers yet, but, at least, we know how to look
for them.
3
Independently evolving individuals 1)
phenotypic plasticity
Obviously, an individual can increase its fitness
by developing the phenotype that suits its
particular environment. The ability to do this is
called phenotypic plasticity. The norm of
reaction of a genotype refers to the set of
phenotypes that can be produces by this genotype
under all feasible environments. Some forms
of phenotypic plasticity may be just imposed by
physical laws, and not evolved - think of low
fecundity under starvation.
When exposed to predators, a growing Daphnia
develops "horns" (left) that offer it some
protection.
4
The tadpoles of Pacific treefrog Pseudacris
regilla develop different shapes in different
environments. In the presence of predatory
insects, tadpoles develop deep tails and bodies,
while in the presence of predatory fish, tadpoles
develop shallow tails and bodies.
5
Plants also often develop very different
phenotypes under different environments, even
when they are genetically identical, as these two
plants are.
6
Independently evolving individuals 2)
non-interactive behavior Let us consider just
one aspect of non-interactive behavior, foraging.
If the environment consists of "patches",
foraging involves two decisions. The first is
whether to enter a patch in search of food, and
the second is to judge how long to continue
searching for food in that location. The predator
attempts to maximize E/(HS), where E is the
energy obtained from prey, S is the search time
involved, and H is handling time that includes
capture, killing, eating and digesting. For a
range of prey, the predators average intake rate
is Eaverage/(HaverageSaverage). When the
predator has found a new item, it has two
choices. It can eat the new item, in which case
the profitability is Enew/Hnew, or it can leave
it and search for an item already in its diet, in
which case the expected profitability is
Eaverage/(HaverageSaverage). The predator
should eat this new item if Enew/Hnew
Eaverage/(HaverageSaverage).
7
This simple analysis leads to several
predictions 1) Predators with long Haverage and
short Saverage should be specialists. Lions have
a very low Saverage but a high Haverage, which
can be prohibitively large for some prey
individuals. 2) Predators with short Haverage
and long Saverage should be generalists and
consume a wide range of items. 3) Only predators
with both Haverage and Saverage being short can
afford using small prey with low Eaverage. An
extreme case of such evolution is provided by
star-nosed moles.
8
Unusual anatomical and behavioral specializations
of star-nosed moles resulted from selection for
speed, allowing the progressive addition of small
prey to their diet. Obviously, this analysis
assumes that evolution can produce optimality,
which may be justified because the phase space is
simple in this case. Of course, there are
trade-off's between E, H, and S - it is
impossible to handle a moose in 120ms.
9
Independently evolving individuals 3)
semelparity and iteroparity Many organisms are
iteroparous, i. e. can reproduce repeatedly,
often in the course of many years. However, some
organisms are semelparous (monocarpic), and
reproduce only once and then die. A three
examples of semelparous species
Agava
Echium
Salmon Semelparity is taxonomically
and ecologically widespread.
10
How can semelparity evolve? Why death after
reproduction is often favored by selection?
Semelparous plants have a higher reproductive
output per episode than iteroparous species. An
organism that puts all available resources into
reproduction will have a higher reproductive
output than an organism that withholds some
resources for future growth and survival. For
example, if a 10 increase in reproductive effort
results in more than a 10 increase in
reproductive success, then this increase will be
favored by selection. If this differential holds
over all levels of reproduction, natural
selection favors putting all resources into
reproduction, i. e. semelparity. Again, we
ignore internal functioning of the organism, and
simply consider different dependencies of R. S.
on R. E.
11
Independently evolving individuals 4)
clutch size Parents can be expected to produce
clutches of the size that maximizes their fitness
(the number of surviving young) - and not the
fitness of each individual offspring. Moreover,
parents can also trade current against future
reproduction, and the optimal clutch size is the
one which maximizes lifetime reproductive
success.
12
Highly fecund organisms sacrifice offspring size
and viability for their increased numbers.
Relation between egg size and relative recapture
rate (scaled to a maximum of 1) of juvenile
Atlantic salmon. Dashed lines represent the
derivative of the function relating maternal
reproductive success to egg size.
13
Independently evolving individuals 5)
dormancy Many species produce eggs or seeds that
refrain from hatching despite developmental
preparedness and favorable environmental
conditions. Instead, these propagules hatch in
intervals over long periods, although their
viability declines with age. Such variable hatch
tactics represents bet-hedging, by maternal
individuals, against future catastrophes and
evolve due to individual selection.
Germination and emergence are stimulated by
environmental cues, but strongly influenced by
maternal controls.
14
Independently evolving individuals 6)
aging Aging (senescence) is a decline in
performance and fitness with advancing age. The
rate of aging is not prescribed by hard laws of
physics, and "why individuals age at a particular
rate?" is a perfectly legitimate evolutionary
question. Should selection be opposed to aging
and favor immortality? Not necessarily there is
no selection in favor of high performance of an
organism at ages that are never reached in nature
.
15
However, this is not the whole story. There are
two possible, fundamentally different, mechanisms
of evolution of aging when potential fitness gain
from old individuals is low 1) Simple neglect
late performance deteriorates without any
associated improvements, due to accumulation of
age-specific deleterious mutations that affect
only old individuals (MA mutation
accumulation). 2) Tradeoff deterioration of
late performance increases early performance, if
the amount of resources allocated on maintenance
decreases, more can be allocated on reproduction
(AP antagonistic pleiotropy). In other words
is aging a part of the optimal life history, due
to hard constraint that prevents evolution from
improving early and late performance of the same
individual?
Suppose that we did all what is possible to
postpone aging without compromising early
performance - by how much aging will be
postponed? Extreme answers are 1)
indefinitely (MA)
and 2) not at all
(AP) but the truth is probably somewhere in
between (J. Evol. Biol. 20, 433-447, 2007).
16
Antagonistic pleiotropy is supported by data from
artificial selection experiments and from
analysis of longevity-enhancing mutations in D.
melanogaster. The artificial selection
experiments used selective breeding from old
individuals.
In one of these experiments, the mean longevity
of females increased by 25 after 15 generations,
but the early-life fecundity was depressed.
Discovery of single-gene mutations that
confer extended longevity also provide support
for the AP model.
B - control population, O - population selected
for reproduction at old age.
17
The MA also received some experimental support. A
unique prediction of this model is that MA should
lead to age-related increases in inbreeding
depression and in the genetic variance of fitness
components.
Perhaps, both AP and MA mechanisms are important
for the evolution of aging, but more data is
needed (TREE 8, 458-463 AUG 2006).
Age-specific estimates of additive genetic
variance in fitness, with standard error bars.
18
Gene transmission 1) mutation Does
mutation occur "out of necessity" or
deliberately? A thought experiment if there were
no cost of DNA handling fidelity, would evolution
lead to zero or to non-zero mutation rates? In
other words, are the natural mutation rates
minimal feasible or optimal? We do not know the
answer. One the one hand, most of
non-neutral mutations are deleterious, so that
reduction of the mutation rate can be favored by
selection. On the other hand, occasional
beneficial mutations are very important, and are
necessary for evolution. If natural mutation
rates are the minimal ones that are not yet
involved with prohibitive cost, evolution occurs
only because laws of physics prevent evolution of
zero mutation rate - which would stop all future
evolution.
19
Gene transmission 2) maintenance of
sex We do not even in the least know the final
cause of sexuality why new beings should be
produced by the union of the two sexual elements,
instead of by a process of parthenogenesis?"
(Darwin, 1861). Sexual forms are often capable of
asex (apomixis, parthenogenesis) facultative
asex is quite common. In particular, many forms
independently evolved "cyclical asex"
A sample of cyclical asexuals a monogonont
rotifer, an aphid, and a cladoceran. However,
sex is only rarely lost completely, and when it
happens, obligate asexuals are usually
evolutionarily young. We known just two examples
of "ancient asexual scandals"
Bdelloid rotifer
Darwinulid ostracod
20
So, what prevents, in almost all cases, the
complete loss of sex? Asex is much more efficient
as a means of self-propagation. Moreover, in the
case of 5050 resource allocation between males
and females, asex confers a two-fold advantage.
A rare clone of asexual females will DOUBLE its
frequency every generation. Clearly, sex must
confer a large, short-term advantage. Sex
apparently does not confer any immediate
physiological benefits. Thus, sex can only be
advantageous due to genetic changes it causes in
the offspring. However, sex does not "improve"
genotypes directly - it does not change allele
frequencies.
21
Thus, sex could only confer an indirect
advantage, by increasing genetic variation and
thus making selection more efficient. Ho
wever, for this mechanism to work, two conditions
must be met 1) some factor(s) must create
non-random associations between distributions of
alleles at different loci - sex can only
randomize genotypes and, without such
associations, it would have no impact. AB
AxB Ab Axb aB axB ab
axb dAB 0 sex does nothing! 2) some
factor(s) must make sure that overrepresented
genotypes have LOW fitnesses - otherwise,
reshuffling these genotypes by sex could only be
deleterious. If AB gt AxB, sex could
be advantageous only if wAB if low!
22
There are two feasible reasons why each of these
two conditions could be met. Thus, we arrive to a
general 2x2 classification of hypotheses on the
maintenance of sex

What makes distributions of
alleles

at different loci non-independent

genetic drift
selection What makes overrepresented
genotypes maladapted changing environment
ES ED
(positive
selection)
deleterious mutations MS
MD
(negative
selection) ES environmental
stochastic, ED environmental
deterministic, MS mutational
stochastic, MD mutational
deterministic. There are some hypotheses that
do not fit into this classification, but they
appear to be unlikely. Thus, let us consider the
four classes of hypotheses ES, ED, MS, and MD.
23
ES (environmental stochastic, or Fisher-Muller)
hypothesis. Sex is beneficial because it can
bring together beneficial mutations that appeared
in different genotypes.
This mechanism could only work if many positive
selection-driven allele replacements occur at the
same time. Apparently, this is not the case. The
same is probably true for a variety of the ED
(environmental deterministic) hypotheses -
selection can hardly fluctuate in the way that
could make sex advantageous. Thus, let us
consider a variety of stochastic hypotheses that
involve deleterious mutations (some of them also
involve beneficial mutations). We already
encountered them.
24
(No Transcript)
25
(a) Accumulation of weakly deleterious mutations
by background selection. In a large,
non-recombining population at mutation-selection
balance, only Y chromosomes free of strongly
deleterious mutations will contribute to the
ancestry of future generations. The effective
population size (Ne) of the Y can therefore be
greatly reduced. This reduces efficiency of
selection and increases the rate of fixation of
weakly deleterious mutations. (b) Muller's
ratchet. This process involves the stochastic
loss of all Y chromosomes carrying the fewest
number of deleterious mutations from a finite
population. In the absence of recombination and
back mutation, this class of chromosomes cannot
be restored. The next best class then replaces it
(i. e. the class of chromosomes with the next
fewest number of deleterious mutations). This
class can in turn be lost, in a succession of
irreversible steps. Each such loss is quickly
followed by the fixation of a deleterious
mutation on the Y. (c) Genetic hitchhiking by
favorable mutations. The spread of a favorable
mutation on a non-recombining Y-chromosome will
drag to fixation any deleterious mutation
initially associated with it. Thus, hitchhiking
requires that selection coefficients for
beneficial mutations are larger than for
deleterious alleles. Successive adaptive
substitutions on an evolving Y chromosome can
lead to the fixation of deleterious mutations at
many loci. (d) Lack of adaptation on the
non-recombining Y chromosome. The rate of
adaptation on a non-recombining chromosome can be
greatly reduced, owing to interference of
positive mutations with linked deleterious
alleles. If selection coefficients for beneficial
mutations are of the same magnitude or smaller
than those for deleterious mutations, only
beneficial mutations on Y-chromosomes free of
deleterious alleles can contribute to
adaptation. Evolutionary advantage of sex can be
due to the same factors that cause degeneration
of non-recombining sex chromosomes. However, all
these mechanisms are long-term loss of sex can
be penalized only after a long delay. This
appears to be a fatal flaw.
26
MD (mutational deterministic) hypothesis. Sex is
beneficial because it increases variance of the
number of deleterious mutations in genotypes,
making narrowing negative selection against them
more efficient.
The most efficient forms of selection, truncation
and truncation-like, are narrowing and, thus,
undermine their own efficiency. Sex can restore
it, by randomizing the distribution of
deleterious alleles within the population, and
greatly diminish the mutation load. This
mechanism can work under two conditions 1) U
gt 1, as otherwise L is low even without sex.
Recent data indicate that U gt 1. 2) Narrowing
selection (truncation-like selection, selection
with synergistic epistasis) against deleterious
mutations - this is controversial. We still do
not know why sex is the prevailing more of
reproduction in eukaryotes.
27
Gene transmission 3) crossing-over Generall
y, crossing-over within sexual population is
favored under the same conditions that favor sex
over asex. However, in order to make
crossing-over in a multochromosome genome
substantially beneficial, some really strong
selection must operate. A simple graph shows why
this is the case
If the genetic load is less than 50 under
truncation selection, the immediate impact of
crossing-over which increases the variance of the
trait under selection is to reduce
fitness. Only if the genetic load is over 50
under truncation selection, the immediate impact
of crossing-over is to increase fitness.
Thus, we the ubiquity of crossing-over is even
more mysterious than the ubiquity of sex. It is
wrong to claim that crossing-over is simply
necessary for meiosis.
28
Gene transmission 4) systems of
mating Usually, sex is accompanied by
differentiation of gametes. Two kinds of gamete
classes are particularly important 1) Female
(large) and male (small) gametes, a phenomenon
known as anisogamy. The malefemale dichotomy has
evolved independently in nearly all clades of
multicellular organisms. 2) Exogamous
classes of gametes different from female-male
dichotomy (mating types). They are common in
ciliates, basidiomycetes, and flowering
plants. Inbreeding depression, is the
likely cause of the evolution of such classes.
Other mechanisms of inbreeding avoidance,
including social taboos, are also common.
29
Gene transmission 5) origin of sex We have
no direct data on the origin of sex, because it
probably evolved before diversification of modern
eukaryotes. Still, there is a plausible scenario
for gradual origin of sex from asex 1) Asexual
ploidy cycle - alternation of genome duplications
and reductions. Such cycles are known in several
protozoans. 2) Origin of outcrossing by
occasional cell fusions, followed by genetic
reduction due to random chromosome loss. 3)
Origin of regular amphimictic life cycle and
crossing-over (from the already present
mechanisms of DNA repair).
Nobody knows whether this is what actually
happened - but there is no reasons to claim that
gradual origin of sex by natural selection is
impossible.
30
Gene transmission 6) outcomes of genetic
conflicts Without sex, all genes that
constitutes a genotype are in the same boat,
forever. In contrast, sex makes different genes
from the same genotype independent. This opens a
possibility for conflicts between different genes
in sexual populations.
An example of a genetic conflict Mitochondria
are inherited maternally. An allele of a
mitochondrial gene that forces the organism to
produce only ovules would spread in the
population.
Left this is what a nuclear gene wants - we will
soon see, why. Right this is what a
mitochondrial gene wants.
31
A genetic conflict occurs when the spread of an
allele lowers the fitness of its
bearer. Segregation distorters (SD) is a
common class of selfish alleles that create
genetic conflicts by distorting fair Mendelian
segregation. Segregation distorters are
known in Drosophila, mouse, and many other
organisms.
32
Selfish elements involved in conflicts are often
efficiently suppressed. Male killing, in which
maternally inherited micro-organisms distort the
sex ratio by killing male embryos, is the most
deleterious form of sex ratio distortion for the
host, leading to the double fitness cost of
mortality and failure to produce the rare sex.
Suppression of male killer wBol1 evolved recently
in many populations of Hypolimnas bolina.
Independent evolution of selfish elements and
their suppressors in different lineages may
create Dobzhansky-Muller incompatibilities
between them.
33
How important are genetic conflicts in general?
If individual genes are selfish and can pursue
their own evolutionary "interests", should we
regard organisms just as temporary assemblages of
genes of very limited importance? Probably, the
answer is negative asexuals, protected from
tyranny of individual genes pursuing their own
interests are not much different from
sexuals. There are also more
complex conflicts that involve different
organisms - parent-offspring, male-female, etc.
They will be considered later.
Left A bdelloid rotifer - fully asexual for 100
My, master of its genes. Right A monogonont
rotifer - facultatively asexual, but going
through sex regularly.
34
Quiz Propose an experiment that could finally
determine what evolutionary mechanism is
responsible for the maintenance of sex (I need
ideas for the next grant application).