Chap. 8. Problem 1.

1
Chap. 8. Problem 1.
Hydrogen bonds can potentially be formed to each
of the four nitrogen atoms in a purine ring (N-1,
N-3, N-7, and N-9). Since N-1 is involved in
Watson-Crick base pairing to cytosine in DNA, and
N-9 is tied up in the N-glycosyl linkage to
deoxyribose in the nucleotides of DNA and has
very limited hydrogen bonding ability, only N-3
and N-7 are freely available to form other
hydrogen bonds.
2
Chap. 8. Problem 2.
The base sequence of a DNA strand complementary
to a written sequence is conventionally written
in the left-to-right (5 to 3) direction, even
though its sequence runs right-to-left relative
to the printed sequence. The sequence of the
complementary strand therefore is (5)GCGCAATATTTT
GAGAAATATTGCGC(3). As shown by writing the
double-helical sequence of this DNA, this DNA
segment contains a palindrome, which is
underlined. (5)GCGCAATATTTCTCAAAATATTGCGC(3) (3
)CGCGTTATAAAGAGTTTTATAACGCG(5) A single DNA
strand containing this sequence therefore has the
potential to form a hairpin structure. The two
strands together in double-helical DNA could form
a cruciform structure.
3
Chap. 8. Problem 5.
Both single-stranded DNAs and RNAs will form
hairpin structures if they contain complementary
regions. In the double-helical parts of both DNA
and RNA hairpins, the nucleic acid strands are
oriented antiparallel to one another. However,
RNA is unable to form a B-form double helix, and
exists instead in an A-form helix. DNA hairpins
adopt standard B-form helices. The reason for
this difference is that the 2-hydroxyl groups in
the ribose residues of RNA make it sterically
impossible for a double-helical RNA molecule to
adopt a B-form type of helix.
4
Chap. 8. Problem 6.
Eukaryotic DNAs contain large amounts (about 5)
of 5-methylcytosine residues at CpG sequences due
to methylation processes that are involved in the
regulation of gene expression. When
5-methylcytosine undergoes spontaneous
deamination to thymine, a G/T mismatch pair is
produced. Because 5-methylcytosine is prevalent
in DNA, G/T mismatches are common. Therefore, a
specialized system that repairs G/T mismatches to
G/C (and not A/T) base pairs has evolved.
5
Chap. 8. Problem 8.
As a result of the loss of the purine base at an
apurinic (AP) site, structural changes occur that
lead to destabilization of double-helical DNA.
First, the deoxyribose formerly holding the
purine base can open to its linear aldehyde form.
Second, base stacking interactions between the
apurinic nucleotide and its neighbors are lost.
These changes destabilize the local structure of
the double helix in the affected region.
6
Chap. 8. Problem 10.
The bases in double-helical DNA are stacked on
top of one another inside the helix. In this
environment, they are less exposed to light
directed upon them. However, when DNA is
denatured, the bases of the individual single
strands move out of the interior of the double
helix and are more exposed to light focused on
the solution. For this reason, a hyperchromic
effect is observed where the absorption of UV
light by the solution containing the denatured
DNA increases.
7
Chap. 8. Problem 13.
If dCTP were omitted from the C sequencing
reaction, ddCTP would be incorporated into the
growing chain synthesized by the DNA polymerase
as soon as it encountered the first G residue in
the template. No chains longer than this product
would be made, and only one band corresponding to
this product would appear in the sequencing gel.
Under these conditions, the C reaction would not
work correctly.
8
Chap. 8. Problem 16.
(a) Water participates directly in DNA damaging
reactions such as depurination. It also is the
solvent in which mutation-causing enzymes
operate. Thus the low water content of spores is
protective against the accumulation of mutations
in DNA.
(b) Cyclobutane dimers are formed by the
absorption of UV light by adjacent pyrimidines in
DNA. Spores of B. subtilis are constantly at risk
of being exposed to UV light when the soil is
disturbed and spores are lifted into the air and
deposited on the soil surface. The SASP proteins
therefore have evolved to help protect the
genetic information stored in spore DNA.