89 Mac1 PPTs View free & download

MS Paint for Mac1 PowerPoint PPT Presentation

MS Paint for Mac1 - MyBrushes paint for Mac app is the best Mac paint software to paint on Mac infinite canvas and PLAYBACK drawing Paintbrush for Mac.It's good as ms Paint for Mac. http://mybrushes-app.com/MyBrushes-MAC.html

MyBrushes paint for Mac app is the best Mac paint software to paint on Mac infinite canvas and PLAYBACK drawing Paintbrush for Mac.It's good as ms Paint for Mac. http://mybrushes-app.com/MyBrushes-MAC.html

| PowerPoint PPT presentation | free to download

Paint.net for mac1 PowerPoint PPT Presentation

Paint.net for mac1 - Paint.Net for Mac like MyBrushes, Pinta, and GIMP are some equivalents digital artists can choose to use Paint.Net Mac. http://mybrushes-app.com/drawing-tool/paint.net-for-mac-equivalent.html

Paint.Net for Mac like MyBrushes, Pinta, and GIMP are some equivalents digital artists can choose to use Paint.Net Mac. http://mybrushes-app.com/drawing-tool/paint.net-for-mac-equivalent.html

| PowerPoint PPT presentation | free to download

Disambiguating Toponyms in News PowerPoint PPT Presentation

Disambiguating Toponyms in News - Retrieve geographically-relevant news documents ... e.g., 'Washington' is predominantly a Capital in MAC1 ... Test on news with disambiguators stripped out ...

Retrieve geographically-relevant news documents ... e.g., 'Washington' is predominantly a Capital in MAC1 ... Test on news with disambiguators stripped out ...

| PowerPoint PPT presentation | free to view

PEO C4I/IT Seminar Brief - CANES - Aug 08 PowerPoint PPT Presentation

PEO C4I/IT Seminar Brief - CANES - Aug 08 - Voice, Video on SR and SCI enclaves. MAC1 for system critical services (Secret enclave only) ... Hosting Up To Near-Real Time Combat Support applications ...

Voice, Video on SR and SCI enclaves. MAC1 for system critical services (Secret enclave only) ... Hosting Up To Near-Real Time Combat Support applications ...

| PowerPoint PPT presentation | free to view

Conventional Solutions to Environmental Problems Command-and-Control Approach PowerPoint PPT Presentation

Conventional Solutions to Environmental Problems Command-and-Control Approach - Title: Conventional Solutions Author: J.M. THOMAS Last modified by: PDF Maker Created Date: 1/18/2003 9:40:56 PM Document presentation format: On-screen Show

Title: Conventional Solutions Author: J.M. THOMAS Last modified by: PDF Maker Created Date: 1/18/2003 9:40:56 PM Document presentation format: On-screen Show

| PowerPoint PPT presentation | free to download

Evid - Title: O que Biogeografia? Author: Raul Last modified by: Raul Document presentation format: Apresenta o na tela (4:3) Other titles: Arial ...

Title: O que Biogeografia? Author: Raul Last modified by: Raul Document presentation format: Apresenta o na tela (4:3) Other titles: Arial ...

| PowerPoint PPT presentation | free to download

Economic Solutions to Environmental Problems The Market Approach PowerPoint PPT Presentation

Economic Solutions to Environmental Problems The Market Approach - Title: Market Solutions Author: J.M. THOMAS Last modified by: PDF Maker Created Date: 1/18/2003 9:40:56 PM Document presentation format: On-screen Show

Title: Market Solutions Author: J.M. THOMAS Last modified by: PDF Maker Created Date: 1/18/2003 9:40:56 PM Document presentation format: On-screen Show

| PowerPoint PPT presentation | free to download

C. Llanos2,4 ,M. Ayala-Rinc PowerPoint PPT Presentation

C. Llanos2,4 ,M. Ayala-Rinc - Applying rewriting techniques in hardware design [Arvind et al] ... high level abstraction of functional languages is suitable for hardware design ...

Applying rewriting techniques in hardware design [Arvind et al] ... high level abstraction of functional languages is suitable for hardware design ...

| PowerPoint PPT presentation | free to download

Convergence of Wired and Wireless Networks PowerPoint PPT Presentation

Convergence of Wired and Wireless Networks - ... of the Internet from any digital mobile or stationary device at high-speed ... Test Traffic. Received by FAP3. Streaming video from video server 1 (PC1) ...

... of the Internet from any digital mobile or stationary device at high-speed ... Test Traffic. Received by FAP3. Streaming video from video server 1 (PC1) ...

| PowerPoint PPT presentation | free to view

The NearMe Wireless Proximity Server PowerPoint PPT Presentation

The NearMe Wireless Proximity Server - The NearMe Wireless Proximity Server John Krumm and Ken Hinckley Microsoft Research Redmond, WA, USA The Basic Idea Location vs. Proximity Who Cares?

The NearMe Wireless Proximity Server John Krumm and Ken Hinckley Microsoft Research Redmond, WA, USA The Basic Idea Location vs. Proximity Who Cares?

| PowerPoint PPT presentation | free to download

Nat. Rev. Canc, 7, 834 PowerPoint PPT Presentation

Nat. Rev. Canc, 7, 834 - Nat. Rev. Canc, 7, 834 Pre-metastatic niche in lymph node Micrometastatic/metastatic niche Primary Breast Tumor Kaplan and Lyden reviews Open questions

Nat. Rev. Canc, 7, 834 Pre-metastatic niche in lymph node Micrometastatic/metastatic niche Primary Breast Tumor Kaplan and Lyden reviews Open questions

| PowerPoint PPT presentation | free to download

Passive DAD - In wireless networks, it takes long time to get ICMP echo response, or even the ... server does not know if an IP is still used or not before the lease is expired. ...

In wireless networks, it takes long time to get ICMP echo response, or even the ... server does not know if an IP is still used or not before the lease is expired. ...

| PowerPoint PPT presentation | free to download

A Witness Based Approach For Data Fusion Assurance In Wireless Sensor Networks W. Du, J. Deng, Y. Han, P. Varshney PowerPoint PPT Presentation

A Witness Based Approach For Data Fusion Assurance In Wireless Sensor Networks W. Du, J. Deng, Y. Han, P. Varshney - Concept of A(j): the even that all the nodes polled by the base ... Message overhead and polling overhead analyzed for both schemes ...

Concept of A(j): the even that all the nodes polled by the base ... Message overhead and polling overhead analyzed for both schemes ...

| PowerPoint PPT presentation | free to view

Nat. Rev. Canc, 7, 834 - Nat. Rev. Canc, 7, 834 Pre-metastatic niche in lymph node Micrometastatic/metastatic niche Primary Breast Tumor Kaplan and Lyden reviews Open questions

Nat. Rev. Canc, 7, 834 Pre-metastatic niche in lymph node Micrometastatic/metastatic niche Primary Breast Tumor Kaplan and Lyden reviews Open questions

| PowerPoint PPT presentation | free to download

Design and Implementation of WiFiRE MAC Layer Protocol PowerPoint PPT Presentation

Design and Implementation of WiFiRE MAC Layer Protocol - Send in proper sequence in FIFO order at every clock tick ... http://www.cs.utah.edu/dept/old/texinfo/glibc-manual-0.02/library 21.html ...

Send in proper sequence in FIFO order at every clock tick ... http://www.cs.utah.edu/dept/old/texinfo/glibc-manual-0.02/library 21.html ...

| PowerPoint PPT presentation | free to download

aSoC: A Scalable On-Chip Communication Architecture PowerPoint PPT Presentation

aSoC: A Scalable On-Chip Communication Architecture - ECE669: Lecture 24. aSoC: A Scalable On-Chip ... recon. block. DCT. block. DCT. block. Motion. error. R4000. R4000. R4000. MEM. MEM. ECE669: Lecture 24 ...

ECE669: Lecture 24. aSoC: A Scalable On-Chip ... recon. block. DCT. block. DCT. block. Motion. error. R4000. R4000. R4000. MEM. MEM. ECE669: Lecture 24 ...

| PowerPoint PPT presentation | free to download

Defending Against Redirect Attacks in Mobile IP PowerPoint PPT Presentation

Defending Against Redirect Attacks in Mobile IP - Overview of Mobile IP. Router HA. Internet. Router FA. Router. CN. Home network. MN. Foreign ... Home link is associated with a public/private key pair PH and SH ...

Overview of Mobile IP. Router HA. Internet. Router FA. Router. CN. Home network. MN. Foreign ... Home link is associated with a public/private key pair PH and SH ...

| PowerPoint PPT presentation | free to view

Application Layer PowerPoint PPT Presentation

Application Layer - Protokol ini juga mendukung email yang mempunyai format MIME (Multipurpose Internet Mail Extension), dimana user bisa mengirimkan email dengan menyertakan ...

Protokol ini juga mendukung email yang mempunyai format MIME (Multipurpose Internet Mail Extension), dimana user bisa mengirimkan email dengan menyertakan ...

| PowerPoint PPT presentation | free to download

NOVI POGLEDI NA PRACENJE SUSTAVNOG UPALNOG ODGOVORA NAKON PRIMJENE EKC PowerPoint PPT Presentation

NOVI POGLEDI NA PRACENJE SUSTAVNOG UPALNOG ODGOVORA NAKON PRIMJENE EKC - Title

Title

| PowerPoint PPT presentation | free to download

The Architecture and Protocol Design for Underwater Network PowerPoint PPT Presentation

The Architecture and Protocol Design for Underwater Network - Mandar Chitre, Lee Freitag, Ethem Sozer, Shiraz Shahabudeen, Milica Stojanovic, ... Is calculated in MAC layer (32-bit CRC), IP layer and transport layer (16 bits) ...

Mandar Chitre, Lee Freitag, Ethem Sozer, Shiraz Shahabudeen, Milica Stojanovic, ... Is calculated in MAC layer (32-bit CRC), IP layer and transport layer (16 bits) ...

| PowerPoint PPT presentation | free to view

Economic Solutions to Environmental Problems The Market Approach - Title: Market Solutions Author: J.M. THOMAS Last modified by: PDF Maker Created Date: 1/18/2003 9:40:56 PM Document presentation format: On-screen Show

Title: Market Solutions Author: J.M. THOMAS Last modified by: PDF Maker Created Date: 1/18/2003 9:40:56 PM Document presentation format: On-screen Show

| PowerPoint PPT presentation | free to view

SECURITE DU SYSTEME D PowerPoint PPT Presentation

SECURITE DU SYSTEME D - Title: Pr sentation PowerPoint Author: sammoud Last modified by: SWEET Created Date: 9/26/2004 8:41:27 PM Document presentation format: Affichage l' cran (4:3)

Title: Pr sentation PowerPoint Author: sammoud Last modified by: SWEET Created Date: 9/26/2004 8:41:27 PM Document presentation format: Affichage l' cran (4:3)

| PowerPoint PPT presentation | free to download

Message Authentication and Hash Functions PowerPoint PPT Presentation

Message Authentication and Hash Functions - e.g., ASCII text, an appended checksum, or use of layered protocols ... Append an error-detecting code (frame check sequence ... is appended at the ...

e.g., ASCII text, an appended checksum, or use of layered protocols ... Append an error-detecting code (frame check sequence ... is appended at the ...

| PowerPoint PPT presentation | free to view

Chap 11. Message Authentication and Hash Functions PowerPoint PPT Presentation

Chap 11. Message Authentication and Hash Functions - e.g., ASCII text, an appended checksum, or use of layered protocols ... Append an error-detecting code (frame check ... The hash value is appended at the source ...

e.g., ASCII text, an appended checksum, or use of layered protocols ... Append an error-detecting code (frame check ... The hash value is appended at the source ...

| PowerPoint PPT presentation | free to view

Nortel Presentation PowerPoint PPT Presentation

Nortel Presentation - IEEE 802.1ah First Draft. Paul Bottorff. March 14, 2005. 3. P802. ... A different S-VID in each PBN maps to the I-SID. S-VID3. BB PB. BB PB. BB PB. BB PB. BBN ...

IEEE 802.1ah First Draft. Paul Bottorff. March 14, 2005. 3. P802. ... A different S-VID in each PBN maps to the I-SID. S-VID3. BB PB. BB PB. BB PB. BB PB. BBN ...

| PowerPoint PPT presentation | free to download

Presentacin de PowerPoint PowerPoint PPT Presentation

Presentacin de PowerPoint - Ace1 mediates Cu activation of expression of genes involved in ... Cultures were then split; one aliquot was untreated and 100 M CuSO4 was added to the other. ...

Ace1 mediates Cu activation of expression of genes involved in ... Cultures were then split; one aliquot was untreated and 100 M CuSO4 was added to the other. ...

| PowerPoint PPT presentation | free to view

Environmental Policy Instruments PowerPoint PPT Presentation

Environmental Policy Instruments - If resource conservation is not required, firms are free to use natural resources. ... National ambient air quality standards (NAAQS) ...

If resource conservation is not required, firms are free to use natural resources. ... National ambient air quality standards (NAAQS) ...

| PowerPoint PPT presentation | free to view

Wireless Sensor Network Security: The State of the Art PowerPoint PPT Presentation

Wireless Sensor Network Security: The State of the Art - Wireless Sensor Network Security: The State of the Art ASCI Springschool on Wireless Sensor Networks Yee Wei Law The University of Melbourne Prelude In the beginning ...

Wireless Sensor Network Security: The State of the Art ASCI Springschool on Wireless Sensor Networks Yee Wei Law The University of Melbourne Prelude In the beginning ...

| PowerPoint PPT presentation | free to view

TECHNICAL SALES TRAINING 2005 - TECHNICAL SALES TRAINING 2005

TECHNICAL SALES TRAINING 2005

| PowerPoint PPT presentation | free to view

Water Quality Trading David Roberts 28 March 06 PowerPoint PPT Presentation

Water Quality Trading David Roberts 28 March 06 - Economic agents reciprocally harm each other through externalities ... discharge levels, making polluters reciprocally harm each other by using up discharge limits ...

Economic agents reciprocally harm each other through externalities ... discharge levels, making polluters reciprocally harm each other by using up discharge limits ...

| PowerPoint PPT presentation | free to download

Environmental Economics PowerPoint PPT Presentation

Environmental Economics - All firms required to reduce pollution to specific levels. ef is maximum pollution. Forced to cut in half (0.5ef) What are costs of abatement? Firm 1. Firm 2 ...

All firms required to reduce pollution to specific levels. ef is maximum pollution. Forced to cut in half (0.5ef) What are costs of abatement? Firm 1. Firm 2 ...

| PowerPoint PPT presentation | free to download

Caterpillar Cat 320C Excavator (Prefix BER) Service Repair Manual Instant Download - Caterpillar Cat 320C Excavator (Prefix BER) Service Repair Manual Instant Download

Caterpillar Cat 320C Excavator (Prefix BER) Service Repair Manual Instant Download

THE ECONOMICS OF ENVIRONMENTAL QUALITY PowerPoint PPT Presentation

THE ECONOMICS OF ENVIRONMENTAL QUALITY - THE ECONOMICS OF ENVIRONMENTAL QUALITY Field, chapter 5 Equimarginal A and B must have different emission rates but together emit no more than 12 tons of effluent and ...

THE ECONOMICS OF ENVIRONMENTAL QUALITY Field, chapter 5 Equimarginal A and B must have different emission rates but together emit no more than 12 tons of effluent and ...

| PowerPoint PPT presentation | free to download

Caterpillar Cat 320C L Excavator (Prefix BER) Service Repair Manual Instant Download - Caterpillar Cat 320C L Excavator (Prefix BER) Service Repair Manual Instant Download

Caterpillar Cat 320C L Excavator (Prefix BER) Service Repair Manual Instant Download

Environmental Policy Instruments - ... permits (allowances, credits) Information disclosure ... Tax Outputs of Production ... Voluntary programs and agreements (33/50, XL, Energy-star, ISO 14000) ...

... permits (allowances, credits) Information disclosure ... Tax Outputs of Production ... Voluntary programs and agreements (33/50, XL, Energy-star, ISO 14000) ...

| PowerPoint PPT presentation | free to view

Environmental Policy PowerPoint PPT Presentation

Environmental Policy - Energy-star. ISO 14000. 4. Direct government provision. public lands. clean-up. clean technology R&D ... Tax Outputs of Production ...

Energy-star. ISO 14000. 4. Direct government provision. public lands. clean-up. clean technology R&D ... Tax Outputs of Production ...

| PowerPoint PPT presentation | free to view

Transport Protocols and Distributed Applications PowerPoint PPT Presentation

Transport Protocols and Distributed Applications - CGI, PHP, ASP, ... Get a program from the server and run it on the client. Active pages ... Dynamic Host Configuration Protocol. IP address. Static or dynamic ...

CGI, PHP, ASP, ... Get a program from the server and run it on the client. Active pages ... Dynamic Host Configuration Protocol. IP address. Static or dynamic ...

| PowerPoint PPT presentation | free to view

Internetworking PowerPoint PPT Presentation

Internetworking - Behrouz A Forouzan, Data Communications and Networking, 3rd edition, McGraw-Hill. ... Boundary between network and host parts is at a fixed location (for each class) 1 ...

Behrouz A Forouzan, Data Communications and Networking, 3rd edition, McGraw-Hill. ... Boundary between network and host parts is at a fixed location (for each class) 1 ...

| PowerPoint PPT presentation | free to view

Handover for PMIPv6 Using MIH PowerPoint PPT Presentation

Handover for PMIPv6 Using MIH - During L2 HO, the MN stores packets destined for LMA. 12. 28. Procedure contd. ... Packet forwarding(destined for MN) Packet forwarding(from MN) 35. Time Line ...

During L2 HO, the MN stores packets destined for LMA. 12. 28. Procedure contd. ... Packet forwarding(destined for MN) Packet forwarding(from MN) 35. Time Line ...

| PowerPoint PPT presentation | free to view

Vertical Handover for PMIPv6 PowerPoint PPT Presentation

Vertical Handover for PMIPv6 - 1. Vertical Handover for PMIPv6. KANG Joon-Suk. ? ??. 2. Contents ... pMAG starts fording packets destined for MN to nMAG. 802.16 BS (RAS) 802.11 AP. MN. Router ...

1. Vertical Handover for PMIPv6. KANG Joon-Suk. ? ??. 2. Contents ... pMAG starts fording packets destined for MN to nMAG. 802.16 BS (RAS) 802.11 AP. MN. Router ...

| PowerPoint PPT presentation | free to view

Caterpillar Cat 320C Excavator (Prefix BER) Service Repair Manual Instant Download - Caterpillar Cat 320C Excavator (Prefix BER) Service Repair Manual Instant Download

Caterpillar Cat 320C Excavator (Prefix BER) Service Repair Manual Instant Download

LCSim Workshop IV PowerPoint PPT Presentation

LCSim Workshop IV - ... settable by region, especially useful for tweaking secondary / shower physics. ... (LcioHelper), Mokka (PhysicsListFactory), LCS (EndOfEventAction): Thanks, guys! ...

... settable by region, especially useful for tweaking secondary / shower physics. ... (LcioHelper), Mokka (PhysicsListFactory), LCS (EndOfEventAction): Thanks, guys! ...

| PowerPoint PPT presentation | free to download

Caterpillar Cat 320C L Excavator (Prefix BER) Service Repair Manual Instant Download - Caterpillar Cat 320C L Excavator (Prefix BER) Service Repair Manual Instant Download

Caterpillar Cat 320C L Excavator (Prefix BER) Service Repair Manual Instant Download

Politeknik Elektronikan Negeri Surabaya PowerPoint PPT Presentation

Politeknik Elektronikan Negeri Surabaya - Title: Slide 1 Author: Harun Last modified by: Idris Winarno Created Date: 1/8/2006 8:10:01 PM Document presentation format: On-screen Show Company

Title: Slide 1 Author: Harun Last modified by: Idris Winarno Created Date: 1/8/2006 8:10:01 PM Document presentation format: On-screen Show Company

| PowerPoint PPT presentation | free to download

Caterpillar Cat 320C and 320C L Excavator (Prefix BER) Service Repair Manual Instant Download - Caterpillar Cat 320C and 320C L Excavator (Prefix BER) Service Repair Manual Instant Download

Caterpillar Cat 320C and 320C L Excavator (Prefix BER) Service Repair Manual Instant Download

SSH Tricks - SSH Tricks Matthew G. Marsh Overview SSH What is it How does it work Discussion of Network Topology Tricks for multiple hosts Keys and config files MultiHop tricks Q ...

SSH Tricks Matthew G. Marsh Overview SSH What is it How does it work Discussion of Network Topology Tricks for multiple hosts Keys and config files MultiHop tricks Q ...

| PowerPoint PPT presentation | free to download

Sicherheit%20in%20Rechnernetzen PowerPoint PPT Presentation

Sicherheit%20in%20Rechnernetzen - Sicherheit in Rechnernetzen Mehrseitige Sicherheit in verteilten und durch verteilte Systeme Folien zu den Vorlesungen: Einf hrung in die Datensicherheit

Sicherheit in Rechnernetzen Mehrseitige Sicherheit in verteilten und durch verteilte Systeme Folien zu den Vorlesungen: Einf hrung in die Datensicherheit

| PowerPoint PPT presentation | free to download

Topics Today 91608 PowerPoint PPT Presentation

Topics Today 91608 - ... pharmeceutical waste documented in the Wisconsin State Journal the last two days ... An efficient allocation need not be fair. Alternative Views on Efficiency ...

... pharmeceutical waste documented in the Wisconsin State Journal the last two days ... An efficient allocation need not be fair. Alternative Views on Efficiency ...

| PowerPoint PPT presentation | free to view

Semester 1 CHAPTER 11 Le Chi Trung PowerPoint PPT Presentation

Semester 1 CHAPTER 11 Le Chi Trung - ... a LAN, it builds ARP tables that maps IP addresses to MAC addresses in that interface. ... the paths that routed protocols follow to their destinations. ...

... a LAN, it builds ARP tables that maps IP addresses to MAC addresses in that interface. ... the paths that routed protocols follow to their destinations. ...

| PowerPoint PPT presentation | free to view

A1263203935XFZcM PowerPoint PPT Presentation

A1263203935XFZcM - Les r seaux sans fil : point sur les technologies et r flexion sur les usages ... Les autres qui partagent la clef peuvent lire vos trames. Poss de une dur e de vie longue ...

Les r seaux sans fil : point sur les technologies et r flexion sur les usages ... Les autres qui partagent la clef peuvent lire vos trames. Poss de une dur e de vie longue ...

| PowerPoint PPT presentation | free to view

NEbraskaCERT SSH Tricks PowerPoint PPT Presentation

NEbraskaCERT SSH Tricks - NEbraskaCERT SSH Tricks Matthew G. Marsh 05/21/03

NEbraskaCERT SSH Tricks Matthew G. Marsh 05/21/03

| PowerPoint PPT presentation | free to download

S - 802.1x: Les solutions actuelles. Open Source. Freeradius. Xsupplicant (client ... ceci rend caduques les attaques actuelles avec des trames 802.11b falsifi es. ...

802.1x: Les solutions actuelles. Open Source. Freeradius. Xsupplicant (client ... ceci rend caduques les attaques actuelles avec des trames 802.11b falsifi es. ...

| PowerPoint PPT presentation | free to view

Multimedia Lab PowerPoint PPT Presentation

Multimedia Lab - 'others' (projects) about 15 master students per year. MMLab Overview ... The goal of the PeCMan project is to research the major technological challenges ...

'others' (projects) about 15 master students per year. MMLab Overview ... The goal of the PeCMan project is to research the major technological challenges ...

| PowerPoint PPT presentation | free to view

SYSTEMATIC ERRORS IN GPS POSITION ESTIMATES PowerPoint PPT Presentation

SYSTEMATIC ERRORS IN GPS POSITION ESTIMATES - Power Spectral Density of dU Residuals average PSD for 14 continuous stations follows flicker noise large excess power at annual periods phases of annual ...

Power Spectral Density of dU Residuals average PSD for 14 continuous stations follows flicker noise large excess power at annual periods phases of annual ...

| PowerPoint PPT presentation | free to download

Xiuzhen Cheng cheng@gwu.edu PowerPoint PPT Presentation

Xiuzhen Cheng cheng@gwu.edu - Temporal keys are generated from PMK ... Two sets of temporal keys: one for EAPOL handshake and one for data. All temporal keys must be 128 bits in length ...

Temporal keys are generated from PMK ... Two sets of temporal keys: one for EAPOL handshake and one for data. All temporal keys must be 128 bits in length ...

| PowerPoint PPT presentation | free to download

Towards Cracking the Code of Chromatin and Transcriptional Regulation PowerPoint PPT Presentation

Towards Cracking the Code of Chromatin and Transcriptional Regulation - CTAACCTGGCTACAGAATCATAAGTTGAATTCGACAGGTTATCAGCAACAACACAGTCATATCCATTCTCAATTAGCTCTACCACAGTGTGTGAACCAATGTATCCAGCACCACCTGTAACCAAAACAATTTTAGAAGTACTTTCACTTTGTAACTGAGCTGTCAT ...

CTAACCTGGCTACAGAATCATAAGTTGAATTCGACAGGTTATCAGCAACAACACAGTCATATCCATTCTCAATTAGCTCTACCACAGTGTGTGAACCAATGTATCCAGCACCACCTGTAACCAAAACAATTTTAGAAGTACTTTCACTTTGTAACTGAGCTGTCAT ...

| PowerPoint PPT presentation | free to download

Mac1 PowerPoint PPT Presentations