Title: 1' Why do height and skin color have many different phenotypes
11. Why do height and skin color have many
different phenotypes?
- They are controlled by more than one gene.
22.What do the symbols like a square and a circle
represent in a pedigree?
- A male is a square and a female is a circle.
33. What does a doctor use a pedigree chart for?
- They use it to trace genetic disorders or
diseases in a family.
44. What does cloning produce?
- A genetically identical copy.
55.How are peoples DNA different?
- The order of the four nitrogen bases are making
billions of combinations possible.
66. Give an example of a trait controlled by a
gene with multiple alleles.
- Blood is an example of a trait controlled by a
gene with multiple alleles.
77. Other than genes, what other factors affect a
persons height?
- The persons diet and environmental factors.
88. What do XX and XY stand for in the 23rd pair
of human chromosomes?
- XX is a girl and XY is a boy
99. What causes genetic disorders?
- Mutations in the DNA or a chromosome.
1010. What are the symptoms of Cystic fibrosis?
- Thick mucus in the lungs making it hard to
breathe and digest food.
1111.What is a karyotype?
- A picture of all the chromosomes in a cell
arranged in pairs.
1212. What tools do genetic counselors use to
predict genetic disorders? Name three.
- Genetic counselors use tools such as karyotypes,
pedigrees, and Punnett Squares.
1313.What is a DNA fingerprint?
- A picture made from a section of DNA which
looks like a bar code. Every persons is
different because everyones DNA is different
1414. How do police use DNA fingerprinting?
- To solve crimes by matching the suspects DNA to
DNA from a crime scene
1515. What is the purpose of the Human Genome
Project?
- To identify the DNA sequence (nitrogen base
order) of every gene in a human cell. - ACCTTCGCGGCTAATCGTCCGGTACTGG
1616. Do a Punnett Square for a person with AA and
BB blood.
B
B
AB
AB
A
AB
AB
A
1717. What is hybridization?
- Hybridization is when you cross two genetically
different individuals to
produce their desired
traits.
1818. What is a carrier of a trait?
- An organism with one dominant and one recessive
trait. He/she does not show the trait but can
pass it on.
1919. What causes Down Syndrome?
- An extra 21st chromosome.
2020. What is Sickle-cell disease?
- Odd shaped blood cells which create a lack of
oxygen in the blood.
2121. What is purpose of selective breeding?
- To produce an offspring from two selected
parents with desired traits.
2222. What is a phenotype?
- An organisms physical characteristics, or
visible traits.
2323. What is hemophilia?
- When a persons blood clots slowly or not at all.
May bleed internally easily.
2424. What is genetic engineering?
- Inserting a gene from one organism into another
organism to produce an organism with desired
traits
2525. Describe what a pedigree is and what it is
used for.
- A pedigree is a chart used to trace the family
history of a genetic disease
26Blood Types
- The marker molecules on your red blood cells
determine your blood type and the type of blood
that you can safely receive in transfusions.