Title: Ist das alles'''
1Determination of Animal Species by PCR in
Feed Lars Reimann and David Piñero Eurofins
Scientific, Inc. January 17, 2003
2Eurofins Scientific Who Are We?
- Leading global bioanalytical services provider
for - Feed
- Food
- Pharma/Biotechnology
- Cosmetics
- Environmental
- Broad portfolio of 3000 methods and proprietary
assays - gt 2.000 employees
- More than 50 laboratories in Europe and North
America
3USA Presence
- Woodson-Tenent Laboratories Division
- Feed and Feed Ingredients
- Food and Food Ingredients
- Biotechnology testing (GMO, Meat Speciation)
- Authenticity (Adulteration, Traceability)
- Alpha Laboratories Division
- Herbal products
- Food Supplements
4Contents of Presentation
- PCR and Real-Time PCR Technology
- PCR Advantages/Limitations
- Analysis Procedure
- Validation
- Quality Control/Quality Assurance
- Conclusion
5Why Concerned About Meat Speciation
- Meeting Regulatory Restrictions (FDA, EU, Japan,
China) - BSE/Scrapies and other Food Safety Concerns
- Religious Concerns
- Adulteration of High Value Products
- Brand Protection Labelling Issues
6Meat Speciation MethodologiesPCR (Principle and
Types)
- Regular PCR (2 species specific primers)
- RFLP PCR (Restriction Fragment Length
Polymorphism) - Immuno-PCR (PCR-ELISA)
- Semi-Quantitative PCR
- Real-Time PCR
7PCR (Advantages)
- High species specificity
- High sensitivity. Detection limits 0.1 of DNA
present. - Semi-quantitative PCR can provide a rough
estimate of the level of contamination - Real-Time PCR providing quite accurate
quantitation in the less than 10 range - DNA highly stable
8PCR (Limitations)
- Currently no tissue specificity
- Not all tissues contain the same amount of DNA
- Require relatively advanced lab facilities and
instrumentation and highly trained staff - Cost is fairly expensive (75- 300)
- Time (usually gt24 hrs for results)
- Special measures needed for avoidance of
contamination and inhibition
9PCR
- Detects a known DNA sequence by amplification
- Target sequence is duplicated billions of times
- Results obtained can be quantitative or
qualitative - Amplification is done in changing temperature
cycles - Enzyme Thermophyllic TAQ polymerase
- Instrument Thermocycler
10Usual Target Sequences
- Species-specific nuclear satellite DNA (i.e.
Satellites, SINEs, etc.) - Mitochondrial polymorphic multi-copy genes (i.e.
cytB, rDNA)
11Steps in a PCR Cycle
- Denaturation (90-95 º C)
- Primer Annealing (40-70 º C)
- Extension (72 º C)
12 Polymerase Chain Reaction (PCR)
PRIMER ANNEALING
POLYMERASE RECOGNITION
THE STRAND IS DUPLICATED
DENATURATION
MAGNESIUM COFACTOR
EXTENSION
TAAACTAGCGAAACT
GCGTAGTGTGTCTAATCCGTGGACGACTTATT
ATTTGATCGCTTTGACGCATCACACAGATTAGGCACCTGCTGAATAA
TAAACTAGCGAAACTGCGTAGTGTGTCTAATCCGTGGACGACTTATT
CACCTGCTGAATAA
ATTTGATCGCTTTGACGCATCACACAGATTAGG
13(No Transcript)
14Theoretical DNA Amplification
Cycle of DNA copies 1 2 2 4 4 16 10
1,024 15 32,768 20 1,048,576 25 33,554,432
30 1,073,741,824
15Real-Time PCR
Source Boehringer Mannheim Perkin Elmer
Applied Biosystems WWW page
16Denaturation
17Annealing
18Extension
195 Exonuclease Activity
20(No Transcript)
21Analysis Procedure
- Sample Preparation
- DNA Extraction
- PCR Preparation
- PCR
- Post-PCR
22Agarose Gel Electrophoresis
UV Photograph Polaroid
Photograph
23Validation
- Sensitivity
- Specificity
- Primer systems tested against other species
- Primer systems tested against DNA dilutions in
various percentages and/or samples with different
weight-to weight ratios - Accuracy/Precision
- Primer systems tested in replicates against
various matrices of known composition - Robustness
- European sister labs able to duplicate results
24Example Goat Real-Time PCR Sensitivity
.1
- Minimum detection limit 0.05 goat DNA
25Sensitivity of Current Procedures
- Bovine and Caprine Real-Time PCR Sensitivity
0.05 - Poultry, Porcine, Ovine and Caprine standard PCR
sensitivities 0.1 - Bovine standard PCR sensitivity 0.125
- All primer systems tested specific under our
method specifications
26PCR Quality Control/Quality Assurance
- Positive and negative controls
- Extraction controls (Blanks)
- Control reactions (i.e. cytB gene), spikes, IPCs
- Validated primer systems
- All analysis performed at least in duplicate
- Participation in sponsored check sample programs/
collaborative studies - Internal validation trials
27Conclusion
- PCR and Real-Time PCR have proven to be rugged
methods for determining the species represented
in animal protein products - No single test conclusively addresses the issue
of regulatory compliance - Theoretically, no current battery of tests can
conclusively confirm failure to comply with
current regulations
28Thank you
29Contact us
- Lars Reimann
- Telephone 001.901.272.7511 Ext. 112
- Fax 001.901.272.2926
- Email larsreimann_at_eurofins.com
- David Pinero
- Telephone 001.515.265.1461
- Fax 001.515.266.5453
- E-mail davidpinero_at_eurofins.com