Title: DNA FINGERPRINTING:
1DNA FINGERPRINTING THE BASICS
2Look around the room.
- List 5 differences between yourself and others in
the room. - 1.
- 2.
- 3.
- 4.
- 5.
3DNA Fingerprinting
- Used for forensics, paternity testing, and
identification of remains - Small quantities of blood, semen or body tissue
can be tested for DNA base sequences - Each person has their own unique DNA fingerprint
(nucleotide sequence) except for identical twins
4Most DNA is contained within the nucleus
5Some DNA is contained within the mitochondria of
the cell
6(No Transcript)
7How to do DNA FingerprintingThe Big Picture
Collect Tissue Sample
gt20 cells
gt1000 cells
RFLP / Southern blot
PCR Analysis
8How does DNA fingerprinting work?
- Restriction enzymes cut DNA
- Pieces of DNA are run through a gel
electrophoresis tray - The DNA is probed with a labeled marker
- The pieces of DNA separate out by weight and make
a banding pattern that is unique to an individual
(fingerprint) - Only about 10 regions are tested
- The probability of having matching DNA
fingerprints is 1 in 1 million
9Step 1 Collect the tissue and isolate the DNA
- Lyse (break open) the cells
- Get rid of the proteins and lipids with organic
solvent (e.g. phenol) - Precipitate the nucleic acid with ethanol
10(No Transcript)
11Step 2 Cut and run DNA out on a gel
12Restriction endonucleases aka Restriction enzymes
- Recognize specific base sequences in DNA
- Cut DNA at those recognition sites
13 Step 3 Blot and probe gel- the Southern Blot
14(No Transcript)
15Need a probe A short single stranded DNA which
is complementary to the region of interest
CAGTATACACAAGTACCGTACCTGGCTCAGTTATACGCCGA
A probe will base pair to the region of interest
16 Variable Nucleotide Tandem Repeats (VNTRs)
- VNTRs are short segments of DNA that repeat a
few to hundreds of times - These unusual repeats occurs many different
spots on human chromosomes - Each individual will have different numbers of
these VNTRs at each of these spots - Each of these spots, or loci, are given
different names (MSRs, STRs, AmpFLPs, etc) - VNTRs are inheritable the numbers of repeats
at each location in you are a random combination
of the VNTRs in your parents
17RFLP Analysis
- RFLP Restriction Fragment Length
Polymorphism for related DNA molecules, a
difference in DNA fragment sizes after
restriction enzyme digestion - Difference results from presence of different DNA
sequences - Certain regions of genome are highly variable
18Simple Tandem Repeats(STRs)
STR region of DNA containing tandem copies of
di-, tri- or tetranucleotide repeat
units Examples Dinucleotide repeats
GTGTGTGTGTGT
Trinucleotide repeats ACGACGACGACG
Tetranucleotide repeats TATCTATCTATC
19- Number of repeats varies greatly between
individuals - STRs make up 10-15 of the mammalian genome
- STRs are also called microsatellites
- STRs are junk DNA
- Y-STRs- STRs specific for the Y chromosome
20PCR
Purpose Quickly make many copies of a region
of a DNA molecule Method Multiple rounds of
DNA replication Components in PCR reaction
Target DNA, nucleotides, DNA polymerase, and
primers
21PCR to Amplify a Persons DNA
- Steps Involved
- Isolate a persons
- Design primers
22- Add vast excess of the primers and heat mixture
to 75 oC - This causes DNA strands to separate by breaking
hydrogen bonds between bases
4. Cool to 15 oC. Primers hydrogen bond (anneal)
to complementary strands
23- Add DNA polymerase and all four types of
nucleotides. The polymerase (enzyme used in DNA
replication) will fill in the rest of the two
strands. - You now have two identical copies of the DNA you
started with.
6. REPEAT !!!!!!
24(No Transcript)
25If all RFLP and STR regions are considered, there
is a one in 3.4 billion chance of error. This
means there may be one other person on the planet
that would be too similar to tell the
difference. If other VNTR regions are also
considered, the chances of error go way, way
down Clearly, suspect one is the match..