Chapter 13: Genetic Engineering

1
Chapter 13 Genetic Engineering
2
How could you get a desired trait without
directly manipulating the organisms DNA?

• Selective Breeding
• - choosing organisms with desired traits to
  produce the next generation
• Breeding the winners of a horse race (Smarty
  Jones)
• Selecting a person with a certain eye color or
  features
• Taking the seeds from the Great Pumpkin
  

3
Hybridization

• Crossing organisms of different traits to produce
  a hardier product
• Ex. A mule is a cross of a horse and a donkey
  Sturdy and surefooted
• Hybrid corn tastes good and is more resistant
  to disease.

4
Inbreeding

• Maintaining the present genes by breeding only
  within the population
• Ex. Pedigree animals
• Risk with dipping into the same gene pool and
  recessive traits showing
• up that may be lethal or harmful.

5
Inducing mutations

• By using known mutagens, attempt to force
  mutations to occur
• Radiation Chemicals
• Not a sure bet nor do you know what you are going
  to get
• Polyploidy (3N or 4N) plants have resulted from
  this larger hardier

6
Glofish the first genetically modified animal
to be sold as a pet
7
Now lets manipulate the genes by altering the
organisms DNA

• DNA Technology science involved in the ability
  to manipulate genes/DNA
• Purpose
• Treat disease (Cystic Fibrosis)
• Treat genetic disorders (Hemophilia, diabetes)
• Improve food crops (better tasting, longer shelf
  life, fungus resistance)
• Improve human life in general
• Forensic purposes

8
The Tools

• DNA Extraction Chemical procedure (we did this)
  to isolate DNA
• Restriction enzymes molecular scissors that cut
  DNA at specific nucleotide sequences
• Gel Electrophoresis method to analyze fragments
  of DNA cut by restriction enzymes through a gel
  made of agarose (molecular sieve)
• DNA Ligase molecular glue that puts pieces of
  DNA together
• Polymerase Chain Reaction (PCR)- molecular copy
  machine. Makes millions of copies of DNA/hr

9
Lets suppose that you are a diabetic and can not
make your own insulin. What are you to do?

• Inject insulin of course but from what source?
• Old method was to use sheep insulin. Costly and
  labor intensive also tough on the sheep
• New method Let bacteria with a human insulin
  producing gene make it for you

10
The New Method

• Transformation of a bacterium to produce human
  insulin
• 1. Extract the insulin producing gene from a
  healthy human
• 2. Using a restriction enzyme, cut the insulin
  producing gene out of a the DNA

11
What are restriction enzymes?

• Bacterial enzymes used to cut bacteriophage DNA
  (viruses that invade bacteria).
• Different bacterial strains express different
  restriction enzymes
• Restriction enzymes recognize a specific short
  nucleotide sequence Recognition site
• For example, Eco RI recognizes the sequence
• 5 - G A A T T C - 3
• 3 - C T T A A G - 5
• Palindrones same base pairing forward and
  backwards

12
(No Transcript)
13
Lets try some cutting

• Using this piece of DNA, cut it with Eco RI
• G/AATTC
• 5 GACCGAATTCAGTTAATTCGAATTC
• 3 CTGGCTTAAGTCAATTAAGCTTAAG
• 5 GACCG/AATTCAGTTAATTCG/AATTC
• 3 CTGGCTTAA/GTCAATTAAGCTTAA/G

14
What results is

• GACCG AATTCAGTTAATTCG AATTC
• CTGGCTTAA GTCAATTAAGCTTAA G

Sticky end - tails of DNA easily bind to other
DNA strands
Sticky end
15
Blunt Sticky ends

• Sticky ends Creates an overhang. Bam HI
• Blunts- Enzymes that cut at precisely opposite
  sites without overhangs. SmaI is an example of an
  enzyme that generates blunt ends

16
Cut cloning vectorCarry the desired gene

• Use bacterial plasmids
• Plasmids will be cut with the same restriction
  enzyme used to cut the desired gene

17

• 4. Ligation - Donor gene (desired gene) is then
  spliced or annealed into the plasmid
• using DNA ligase as the glue.
• Recombinant DNA - DNA with new piece of
  genetic information on it
• 5. Plasmid is then returned to bacterium and
  reproduces with donor gene in it.
• Transgenic organism organism with foreign
  DNA incorporated in its genome (genes)
• 6. Bacterium reproduces and starts producing
  human insulin gene which we harvest from them.

18
Recombinant DNA
Donor Gene
19
(No Transcript)
20
Practical Use of DNA technology

• Pharmaceutical products insulin, HBCF (human
  blood clotting factor), Human Growth Hormone
• Genetically engineered vaccines to combat viral
  infections (pathogenic disease causing) your
  body recognizes foreign proteins, produces
  antibodies. Introduced viral proteins will
  trigger an immune response and the production of
  antibodies

21

• 3. Increasing agricultural yields
• New strains of plants GMO Genetically
  modified organism
• Insect resistant plants Insert gene that
  digests larvae when larvae try to eat the plant
  Not always specific to harmful species!!
  Monarch problem
• Disease resistance Fungal resistance in
  tomatoes, corn, soybean
• Herbicide resistance - Round Up wont harm the
  good plants, only the bad plants (weeds)
  cheaper and less labor extensive than weeding
• Getting genes from Nitrogen fixing bacteria
  inserted into plants fix their own nitrogen (a
  must for plants) in N poor soils
• Salt tolerant plants can grow plants where high
  concentrations of salt in the air or soil

22

• Improve quality of produce
• - Slow down the ripening process ship when
  un-ripened, to market when ripe Flava Sava
  gene
• - Enhance color of produce
• - Reduce hairs or fuzz on produce
• - Increase flavor
• - Frost resistance
• Drought resistance

23
The negatives

• Problem with transgenic foods is that an
  introduced gene may produce a protein that
  someone may be sensitive to.
• FDA does not require that on a label (here in the
  US)
• If a label starts with a (8), then its a GMO
  product 84011 GMO banana
• Also, may create superweeds that cross
  pollinate with others may take over environment

24
Cloning

• Growing a population of genetically identical
  cells from a single cell.
• 1997 - Ian Wilmut with Dolly, the cloned sheep
• Remove nucleus from egg cell
• Fuse de-nucleated cell with a body cell from
  another adult
• Cells fuse to become 2N and then divides
• Implant embryo in reproductive system of foster
  mother

25
Hello Dolly!
26
DNA Fingerprinting

• Using cut DNA at specific sites to determine the
  source of the DNA.
• Analyzes sections of DNA that have little to no
  function but vary greatly from one person to the
  next (called repeats)
• RFLP analysis Well do this in lab
• Restriction Fragment Length Polymorphism

27
How is it done?

• RFLP analysis Restriction fragment length
  polymorphism. We each have non-coding segments
  on our DNA. (Old genes)
• Extract DNA sample from blood or tissues
• Cut DNA using restriction enzymes. Fragment
  lengths varies with each person
• Separate fragments by gel electrophoresis
  separates DNA fragments by the of base pairs
  (length of the fragment) and charge
• 4. Place DNA sample into wells in the agarose gel
  molecular sieve
• 5. Run a current through the gel. The DNA
  (negatively charged) will migrate from (-) to ()
• The larger fragments will not migrate that far.
  The small fragments will go the furthest.
• 7. Stain gel and bands in a dye or use a
  radioactive probe to analyze the banding

28

• Electrophoresis electro electricity phoros
  to carry across
• Makes it possible to determine the genetic
  differences and the evolutionary relationship
  among species of organisms
• Method that separates macromolecules (Nucleic
  acids or proteins) on the basis of size, electric
  charge and other physical properties

29

• Who did it? Suspect 1 or 2
• 1s fingerprint matches the evidence left.
  
• Neither Suspect 2 nor the Victim matches 1.
• Therefore, 1 did it!!

30
(No Transcript)
31

• Your repeats are inherited from your parents
• Shown below are the repeat patterns for the Mom
  blue, the Dad yellow
• Their four children
• D1 (the Mom and Dads biological daughter)
• D2 (the Dads step-daughter, child of the Mom and
  her former husband red)
• S1 (their biological son)
• S2 (their' adopted son, not biologically related
  his parents are light and dark green).

32
Gene Therapy

• Treatment of a genetic disorder (like cystic
  fibrous) by correcting a defective gene that
  causes a deficiency of an enzyme.
• Nasal spray that carries normal enzyme gene. Body
  makes enzyme and patient breathes normally.
  Regular treatments necessary
• Has not been proven to be successful in the long
  term

33
                                                                                                                                                          
.

1. The healthy gene is inserted into a virus
   (retrovirus).
2. The (retro)virus is inserted into the patient (by
   injection or inhalation).
3. The (retro)virus enters the unhealthy cells and
   transfers the healthy gene into the unhealthy
   cells' DNA.
4. Now when the cells divide, the new cells will
   contain the healthy gene.