51 Macroarray PPTs View free & download

Macroarray technology PowerPoint PPT Presentation

Macroarray technology - Reverse Transcription. cDNA's. Modified from. D. Moraga . cDNA libraries ... Reverse transcription. Digestion. Addition of adapters. Denature and mix samples ...

Reverse Transcription. cDNA's. Modified from. D. Moraga . cDNA libraries ... Reverse transcription. Digestion. Addition of adapters. Denature and mix samples ...

| PowerPoint PPT presentation | free to view

Grapevine Trunk Disease: The Road Travelled, from Disarray to Macroarray Dan O PowerPoint PPT Presentation

Grapevine Trunk Disease: The Road Travelled, from Disarray to Macroarray Dan O - Grapevine Trunk Disease: The Road Travelled, from Disarray to Macroarray Dan O Gorman, Paula Haag and Jos rbez Torres Pacific Agriculture Research Centre ...

Grapevine Trunk Disease: The Road Travelled, from Disarray to Macroarray Dan O Gorman, Paula Haag and Jos rbez Torres Pacific Agriculture Research Centre ...

| PowerPoint PPT presentation | free to view

Microarrays: Tools PowerPoint PPT Presentation

Microarrays: Tools - 'A microarray is a tool for analyzing gene expression that consists of a small ... Pyxis CattleArray 7600. Bovine total leukocyte cDNA library & immune gene amplicons ...

'A microarray is a tool for analyzing gene expression that consists of a small ... Pyxis CattleArray 7600. Bovine total leukocyte cDNA library & immune gene amplicons ...

| PowerPoint PPT presentation | free to view

Pesquisas em genoma funcional PowerPoint PPT Presentation

Pesquisas em genoma funcional - Title: Slide 1 Author: Fisiologia Vegetal Last modified by: Usuario Created Date: 5/31/2003 1:56:47 PM Document presentation format: Apresenta o na tela

Title: Slide 1 Author: Fisiologia Vegetal Last modified by: Usuario Created Date: 5/31/2003 1:56:47 PM Document presentation format: Apresenta o na tela

| PowerPoint PPT presentation | free to download

Measuring gene expression PowerPoint PPT Presentation

Measuring gene expression - Measuring gene expression RNA blotting RT-PCR RT-PCR RT-PCR 10 copies 100 1,000 10,000 100,000 1,000,000 10,000,000 28 cycles 4 x 103 copies Green fluorescent protein ...

Measuring gene expression RNA blotting RT-PCR RT-PCR RT-PCR 10 copies 100 1,000 10,000 100,000 1,000,000 10,000,000 28 cycles 4 x 103 copies Green fluorescent protein ...

| PowerPoint PPT presentation | free to download

PROLIFERATIVE VITREORETINOPATHY: ARRAY OR DISARRAY - PROLIFERATIVE VITREORETINOPATHY: ARRAY OR DISARRAY

PROLIFERATIVE VITREORETINOPATHY: ARRAY OR DISARRAY

| PowerPoint PPT presentation | free to view

Why do we need to detect pathogens PowerPoint PPT Presentation

Why do we need to detect pathogens - Why do we need to detect pathogens? Who does pathogen ... Disease diagnosis is often a process of elimination ... Geminate. Detection and Diagnosis Methods ...

Why do we need to detect pathogens? Who does pathogen ... Disease diagnosis is often a process of elimination ... Geminate. Detection and Diagnosis Methods ...

| PowerPoint PPT presentation | free to view

DNA Microarray PowerPoint PPT Presentation

DNA Microarray - Suppression Subtractive Hybridization (SSH) Differential screening (plus/minus ... Suppression Subtractive Hybridization (SSH) technique isolates low abundant ...

Suppression Subtractive Hybridization (SSH) Differential screening (plus/minus ... Suppression Subtractive Hybridization (SSH) technique isolates low abundant ...

| PowerPoint PPT presentation | free to view

JS%20111:%20Methods%20used%20to%20Study%20DNA:%20Review%20of%20RFLP%20Multiplex%20PCR%20and%20RT%20PCR-quantification PowerPoint PPT Presentation

JS%20111:%20Methods%20used%20to%20Study%20DNA:%20Review%20of%20RFLP%20Multiplex%20PCR%20and%20RT%20PCR-quantification - JS 111: Methods used to Study DNA: Review of RFLP Multiplex PCR and RT PCR-quantification Learning Objectives a. Distinguish/Type to determine and compare alleles ...

JS 111: Methods used to Study DNA: Review of RFLP Multiplex PCR and RT PCR-quantification Learning Objectives a. Distinguish/Type to determine and compare alleles ...

| PowerPoint PPT presentation | free to download

1.What is a microarray PowerPoint PPT Presentation

1.What is a microarray - Title: PowerPoint Presentation Last modified by: user Created Date: 1/1/1601 12:00:00 AM Document presentation format: Other titles: Times New Roman ...

Title: PowerPoint Presentation Last modified by: user Created Date: 1/1/1601 12:00:00 AM Document presentation format: Other titles: Times New Roman ...

| PowerPoint PPT presentation | free to view

Virtual tour of a Genomics lab PowerPoint PPT Presentation

Virtual tour of a Genomics lab - Anneal primer to template DNA. Add mixture of nucleotides, enzyme. Nucleotides incorporated ... Anneal primer. TCGAAATGCATGCGCATGATT. TCGAAATGCATGCGCGTGATT ...

Anneal primer to template DNA. Add mixture of nucleotides, enzyme. Nucleotides incorporated ... Anneal primer. TCGAAATGCATGCGCATGATT. TCGAAATGCATGCGCGTGATT ...

| PowerPoint PPT presentation | free to view

Nessun titolo diapositiva PowerPoint PPT Presentation

Nessun titolo diapositiva - Title: Nessun titolo diapositiva Author: PV Last modified by: Rebecca Joy Created Date: 5/26/2002 1:59:58 PM Document presentation format: On-screen Show

Title: Nessun titolo diapositiva Author: PV Last modified by: Rebecca Joy Created Date: 5/26/2002 1:59:58 PM Document presentation format: On-screen Show

| PowerPoint PPT presentation | free to download

Genomics - Title: Proteomics Author: Huichun Last modified by: Huichun Created Date: 1/24/2004 2:51:25 AM Document presentation format: Other titles

Title: Proteomics Author: Huichun Last modified by: Huichun Created Date: 1/24/2004 2:51:25 AM Document presentation format: Other titles

| PowerPoint PPT presentation | free to download

From Archaeopteryx to avian genomics - From Archaeopteryx to avian genomics

From Archaeopteryx to avian genomics

| PowerPoint PPT presentation | free to view

Systems Biology through Pathway Statistics PowerPoint PPT Presentation

Systems Biology through Pathway Statistics - Where the cat hunts. BiGCaT Bioinformatics, bridge between two universities ... Steal and smartly adapt a transcriptomics tool: GenMapp/Mappfinder ...

Where the cat hunts. BiGCaT Bioinformatics, bridge between two universities ... Steal and smartly adapt a transcriptomics tool: GenMapp/Mappfinder ...

| PowerPoint PPT presentation | free to view

Prsentation PowerPoint PowerPoint PPT Presentation

Prsentation PowerPoint - using ' Transcriptomics of eukaryotic cells ' to decipher the ... Bifidobacterium breve DN-156 007. Streptococcus thermophilus DN-001 147 ...

using ' Transcriptomics of eukaryotic cells ' to decipher the ... Bifidobacterium breve DN-156 007. Streptococcus thermophilus DN-001 147 ...

| PowerPoint PPT presentation | free to view

JS 113: Introduction to DNA Typing PowerPoint PPT Presentation

JS 113: Introduction to DNA Typing - JS 113: Introduction to DNA Typing Pre class activities Announcements and Assignments Exam 2 Return- Avg 68.1 Range 39-86 II. Learning Objectives

JS 113: Introduction to DNA Typing Pre class activities Announcements and Assignments Exam 2 Return- Avg 68.1 Range 39-86 II. Learning Objectives

| PowerPoint PPT presentation | free to download

UCR Core Instrumentation Facility PowerPoint PPT Presentation

UCR Core Instrumentation Facility - Gene expression services: Affymetrix GeneChip and spotted array capabilities ... of P. infestans, causitive in late blight diseases of potato and tomato. ...

Gene expression services: Affymetrix GeneChip and spotted array capabilities ... of P. infestans, causitive in late blight diseases of potato and tomato. ...

| PowerPoint PPT presentation | free to view

Optimization in Data Mining PowerPoint PPT Presentation

Optimization in Data Mining - Support vector machines or kernel methods. State-of-the-art tool for data mining and machine learning. What is a Support Vector Machine? ...

Support vector machines or kernel methods. State-of-the-art tool for data mining and machine learning. What is a Support Vector Machine? ...

| PowerPoint PPT presentation | free to download

Diapositive 1 - Diapositive 1

Diapositive 1

| PowerPoint PPT presentation | free to view

Advanced Environmental Biotechnology II PowerPoint PPT Presentation

Advanced Environmental Biotechnology II - Advanced Environmental Biotechnology II Week 10 Nucleic Acid Hybridization 8 Applications of nucleic acid hybridization in microbial ecology A.Mark Osborn, Vivien ...

Advanced Environmental Biotechnology II Week 10 Nucleic Acid Hybridization 8 Applications of nucleic acid hybridization in microbial ecology A.Mark Osborn, Vivien ...

| PowerPoint PPT presentation | free to view

CCLI: Establishing a Microarray Teaching and Learning Center in the Shenandoah Valley in Support of Science Education: An NSF Grant and Virginia Community Colleges - CCLI: Establishing a Microarray Teaching and Learning Center in the Shenandoah Valley in Support of Science Education: An NSF Grant and Virginia Community Colleges

CCLI: Establishing a Microarray Teaching and Learning Center in the Shenandoah Valley in Support of Science Education: An NSF Grant and Virginia Community Colleges

| PowerPoint PPT presentation | free to view

Recherches en g PowerPoint PPT Presentation

Recherches en g - Recherches en g nomique foresti re et en protection des arbres contre les maladies et les insectes ravageurs

Recherches en g nomique foresti re et en protection des arbres contre les maladies et les insectes ravageurs

| PowerPoint PPT presentation | free to download

Toxicology in the omics era' PowerPoint PPT Presentation

Toxicology in the omics era' - biomedical research. patients. BiGCaTs lair. informatics. mathematics. computer science ... Genes are part of the chromosomes in the cell nucleus. ...

biomedical research. patients. BiGCaTs lair. informatics. mathematics. computer science ... Genes are part of the chromosomes in the cell nucleus. ...

| PowerPoint PPT presentation | free to view

Transgenic strategies for improvement of drought tolerance of cereals to reduce the consequences of water limitations caused by climate change - Based on the yield performance and photosynthetic activity, Kobomugi represents ... against lipid peroxidation under chemical and drought stresses (Oberschall ...

Based on the yield performance and photosynthetic activity, Kobomugi represents ... against lipid peroxidation under chemical and drought stresses (Oberschall ...

| PowerPoint PPT presentation | free to view

????(Protein Chips) - ? ...

? ...

| PowerPoint PPT presentation | free to view

Bioinformatics Overview PowerPoint PPT Presentation

Bioinformatics Overview - Publication of 'Jurassic Park' 1994: Flavr Savr gains FDA approval ... E. coli 4,600,000 bp 5,400 genes. Yeast 12,000,000 bp 8,000 genes ...

Publication of 'Jurassic Park' 1994: Flavr Savr gains FDA approval ... E. coli 4,600,000 bp 5,400 genes. Yeast 12,000,000 bp 8,000 genes ...

| PowerPoint PPT presentation | free to view

Data Analysis Tools PowerPoint PPT Presentation

Data Analysis Tools - Data Analysis Tools & Techniques II

Data Analysis Tools & Techniques II

| PowerPoint PPT presentation | free to download

Gene expression and DNA microarrays - Gene expression and DNA microarrays

Gene expression and DNA microarrays

| PowerPoint PPT presentation | free to download

A02: Quantitative and qualitative differences in microbial DNA extracted from California soils using three common DNA extraction methods PowerPoint PPT Presentation

A02: Quantitative and qualitative differences in microbial DNA extracted from California soils using three common DNA extraction methods - A02: Quantitative and qualitative differences in microbial DNA extracted from California soils using three common DNA extraction methods E. BENT1, R. FISCHER2, J.O ...

A02: Quantitative and qualitative differences in microbial DNA extracted from California soils using three common DNA extraction methods E. BENT1, R. FISCHER2, J.O ...

| PowerPoint PPT presentation | free to download

Gibson Second Edition PowerPoint PPT Presentation

Gibson Second Edition - Genome Sequencing and Annotation (Part 1)

Genome Sequencing and Annotation (Part 1)

| PowerPoint PPT presentation | free to download

BIONF/BENG 203: Functional Genomics PowerPoint PPT Presentation

BIONF/BENG 203: Functional Genomics - BIONF/BENG 203: Functional Genomics Sources of Functional Data Lectures 1 and 2 Lecture TI 1 Trey Ideker UCSD Department of Bioengineering * Genetic interaction, in ...

BIONF/BENG 203: Functional Genomics Sources of Functional Data Lectures 1 and 2 Lecture TI 1 Trey Ideker UCSD Department of Bioengineering * Genetic interaction, in ...

| PowerPoint PPT presentation | free to view

Gene Inactivation Michael Snyder October 2, 2006 PowerPoint PPT Presentation

Gene Inactivation Michael Snyder October 2, 2006 - Gene Inactivation Michael Snyder October 2, 2006 Problems No phenotype Effects might be indirect Three General Methods 1) Insertional Mutagenesis Transposon ...

Gene Inactivation Michael Snyder October 2, 2006 Problems No phenotype Effects might be indirect Three General Methods 1) Insertional Mutagenesis Transposon ...

| PowerPoint PPT presentation | free to download

Role of the Efflux Pumps in Antimicrobial Resistance in E' coli PowerPoint PPT Presentation

Role of the Efflux Pumps in Antimicrobial Resistance in E' coli - MarA. MarR (MppA) SoxS. SoxR. Webber M. et al. Antimicrob. Agents ... marA disruption mutants of S. Typhimurium remain fully virulent in a murine BALB ...

MarA. MarR (MppA) SoxS. SoxR. Webber M. et al. Antimicrob. Agents ... marA disruption mutants of S. Typhimurium remain fully virulent in a murine BALB ...

| PowerPoint PPT presentation | free to view

Diapositive 1 - Concentration : souvent a 105 cell.ml-1. Distribution verticale : de ... Mise au point de marqueurs du stress UV applicables en milieu naturel. ...

Concentration : souvent a 105 cell.ml-1. Distribution verticale : de ... Mise au point de marqueurs du stress UV applicables en milieu naturel. ...

| PowerPoint PPT presentation | free to view

Mechanisms of Mucosal Defense PowerPoint PPT Presentation

Mechanisms of Mucosal Defense - The Gut Associated Lymphoid Tissue (GALT) - Organized T and B cell areas ... Induces tight junction disassembly and increased intestinal permeability. ...

The Gut Associated Lymphoid Tissue (GALT) - Organized T and B cell areas ... Induces tight junction disassembly and increased intestinal permeability. ...

| PowerPoint PPT presentation | free to view

1' Microsatellites are codominant markers comprising tandemly repeated tracts of DNA, the units of w PowerPoint PPT Presentation

1' Microsatellites are codominant markers comprising tandemly repeated tracts of DNA, the units of w - 4. Prepare master and working stocks of DNA. 5. PCR amplify, with optimized conditions, ... 100 bp. 200 bp. 300 bp. 400 bp. 75 bp. 391. 389I. 437. 19. 389II ...

4. Prepare master and working stocks of DNA. 5. PCR amplify, with optimized conditions, ... 100 bp. 200 bp. 300 bp. 400 bp. 75 bp. 391. 389I. 437. 19. 389II ...

| PowerPoint PPT presentation | free to view

Topographic processing of relational data PowerPoint PPT Presentation

Topographic processing of relational data - Topographic processing of relational data. Barbara Hammer, TU Clausthal, Germany ... converges for every symmetric nonsingular D. Supervision ...

Topographic processing of relational data. Barbara Hammer, TU Clausthal, Germany ... converges for every symmetric nonsingular D. Supervision ...

| PowerPoint PPT presentation | free to view

Transcriptomics applied to Obesity - Transcriptomics applied to Obesity

Transcriptomics applied to Obesity

| PowerPoint PPT presentation | free to view

Hunting strategy of the bigcat PowerPoint PPT Presentation

Hunting strategy of the bigcat - Different conditions show different levels of gene expression for specific genes ... Pascalle Bijnens, Mat Daemen, Frank Stassen, Marc van Bilssen, Marten Hoffker. ...

Different conditions show different levels of gene expression for specific genes ... Pascalle Bijnens, Mat Daemen, Frank Stassen, Marc van Bilssen, Marten Hoffker. ...

| PowerPoint PPT presentation | free to view

European Commission PowerPoint PPT Presentation

European Commission - Tools for the genetic improvement of sea bass - construction and preliminary application of ... Japanese flounder (Coimbra et al. 2004) 1:7.4. Public resource ...

Tools for the genetic improvement of sea bass - construction and preliminary application of ... Japanese flounder (Coimbra et al. 2004) 1:7.4. Public resource ...

| PowerPoint PPT presentation | free to view

JS 111: Methods used to Study DNA: DNA extraction and quantification More on PCR PowerPoint PPT Presentation

JS 111: Methods used to Study DNA: DNA extraction and quantification More on PCR - ... RFLP and PCR require different amounts and different quality of DNA. ... results ... Process one sample at a time, Avoid splashing. Separate reference ...

... RFLP and PCR require different amounts and different quality of DNA. ... results ... Process one sample at a time, Avoid splashing. Separate reference ...

| PowerPoint PPT presentation | free to view

The application of DNA arrays to monitoring or tracking pathogens in the food system PowerPoint PPT Presentation

The application of DNA arrays to monitoring or tracking pathogens in the food system - In genomic profiling experiments, DNA extracted from a sample is fluorescently ... Direct detection of nucleic acids extracted from isolated pathogens (without pre ...

In genomic profiling experiments, DNA extracted from a sample is fluorescently ... Direct detection of nucleic acids extracted from isolated pathogens (without pre ...

| PowerPoint PPT presentation | free to view

DNA Microarraybased test systems: PowerPoint PPT Presentation

DNA Microarraybased test systems: - cancer treatment (chemotherapy; metastasis) Infection ... A70 gene signature was sufficient to indicate whether metastasis do appear soon. r. ...

cancer treatment (chemotherapy; metastasis) Infection ... A70 gene signature was sufficient to indicate whether metastasis do appear soon. r. ...

| PowerPoint PPT presentation | free to view

12103 11:01 PM PowerPoint PPT Presentation

12103 11:01 PM - Inverted T at 3' end (3'-3') slows exonucleolytic degradation ( R-3' ... Is marketed for adult macular degeneration (wet type) From the label: Inverted ribo-T ...

Inverted T at 3' end (3'-3') slows exonucleolytic degradation ( R-3' ... Is marketed for adult macular degeneration (wet type) From the label: Inverted ribo-T ...

| PowerPoint PPT presentation | free to view

Many human genetic diseases are caused by mutations causing missplicing PowerPoint PPT Presentation

Many human genetic diseases are caused by mutations causing missplicing - Alternative 5' splicing. Unwanted = longer exon. Antisense shorter isoform ... B. Bias alternative splicing ratios. Target the unwanted isoform exon-intron joint. ...

Alternative 5' splicing. Unwanted = longer exon. Antisense shorter isoform ... B. Bias alternative splicing ratios. Target the unwanted isoform exon-intron joint. ...

| PowerPoint PPT presentation | free to view

Gene Expression Data Analysis - Gene Expression Data Analysis

Gene Expression Data Analysis

| PowerPoint PPT presentation | free to view

A02: Quantitative and qualitative differences in microbial DNA extracted from California soils using three common DNA extraction methods - 1: Department of Plant Pathology and 2: Department of Nematology, University of ... 56. 0.07. 7.9. 48. 15. 25. 60. 94. 0.74. 5.9. 46. 39. 42. 19. 93. 1.21. 7.0 ...

1: Department of Plant Pathology and 2: Department of Nematology, University of ... 56. 0.07. 7.9. 48. 15. 25. 60. 94. 0.74. 5.9. 46. 39. 42. 19. 93. 1.21. 7.0 ...

| PowerPoint PPT presentation | free to download

JS 12b: DNA - Calvin and Hobbes example- DNA Bank account pays 100% interest every 5 minutes ... Contaminant DNA, such as fungal and bacterial sources, will not amplify because ...

Calvin and Hobbes example- DNA Bank account pays 100% interest every 5 minutes ... Contaminant DNA, such as fungal and bacterial sources, will not amplify because ...

| PowerPoint PPT presentation | free to view

Proteomics, the next step PowerPoint PPT Presentation

Proteomics, the next step - Kinda like the EC commission, a mechanism for uniformity among disparate systems ... pearsoned.com/bookbind/pubbooks/bc_mcampbell_genomics_1/chapter1/deluxe.htm l ...

Kinda like the EC commission, a mechanism for uniformity among disparate systems ... pearsoned.com/bookbind/pubbooks/bc_mcampbell_genomics_1/chapter1/deluxe.htm l ...

| PowerPoint PPT presentation | free to view

The First Generation Linkage Map of the European Sea Bass PowerPoint PPT Presentation

The First Generation Linkage Map of the European Sea Bass - The First Generation Linkage Map of the European Sea Bass ... one microsatellite from sea bream,Sparus aurata (Batargias et al., 1999) 226 AFLP markers ...

The First Generation Linkage Map of the European Sea Bass ... one microsatellite from sea bream,Sparus aurata (Batargias et al., 1999) 226 AFLP markers ...

| PowerPoint PPT presentation | free to view

Macroarray PowerPoint PPT Presentations