104 Ypd PPTs View free & download

DFCI Boston: Using the Weighted Histogram Analysis Method (WHAM) in cancer biology and the Yeast Protein Databank (YPD); Latent Dirichlet Analysis (LDA) for biological sequences and structures - DFCI Boston: Using the Weighted Histogram Analysis Method (WHAM) in cancer biology and the Yeast Protein Databank (YPD); Latent Dirichlet Analysis (LDA) for ...

DFCI Boston: Using the Weighted Histogram Analysis Method (WHAM) in cancer biology and the Yeast Protein Databank (YPD); Latent Dirichlet Analysis (LDA) for ...

| PowerPoint PPT presentation | free to download

Context-Specific Bayesian Clustering for Gene Expression Data PowerPoint PPT Presentation

Context-Specific Bayesian Clustering for Gene Expression Data - Context-Specific Bayesian Clustering for Gene Expression Data ... DDT. sorbitol. Nitrogen Dep. Diauxic shift. YPD. Starvation. YP. Steady. Promoters Analysis ...

Context-Specific Bayesian Clustering for Gene Expression Data ... DDT. sorbitol. Nitrogen Dep. Diauxic shift. YPD. Starvation. YP. Steady. Promoters Analysis ...

| PowerPoint PPT presentation | free to download

Network Biology: understanding the cells functional organization PowerPoint PPT Presentation

Network Biology: understanding the cells functional organization - Analysis. Phylogenetic analysis. Gene neighbors. Co-evolution. Gene clusters ... http://www.incyte.com/sequence/proteome/databases/YPD.html ...

Analysis. Phylogenetic analysis. Gene neighbors. Co-evolution. Gene clusters ... http://www.incyte.com/sequence/proteome/databases/YPD.html ...

| PowerPoint PPT presentation | free to view

Winston Group Meeting PowerPoint PPT Presentation

Winston Group Meeting - Define conserved functions of SAGA subunits. Understand role/mech. ... S.p. 'Sgf73' codon usage in S.c. Total. 15/345 red. 37/345 grey. SAGA swap: design ...

Define conserved functions of SAGA subunits. Understand role/mech. ... S.p. 'Sgf73' codon usage in S.c. Total. 15/345 red. 37/345 grey. SAGA swap: design ...

| PowerPoint PPT presentation | free to download

Molecular Cell Biology of the Yeast Saccharomyces cerevisiae PowerPoint PPT Presentation

Molecular Cell Biology of the Yeast Saccharomyces cerevisiae - ... gene expression, temperature sensitivity, chemical resistance, et ceterus ... PCR-based Gene Engineering. 40-50bp homology arm. each side. Alleles and Phenotypes ...

... gene expression, temperature sensitivity, chemical resistance, et ceterus ... PCR-based Gene Engineering. 40-50bp homology arm. each side. Alleles and Phenotypes ...

| PowerPoint PPT presentation | free to download

Summer research PowerPoint PPT Presentation

Summer research - Title: PowerPoint Author: Veriton Last modified by: Created Date: 8/9/2002 1:34:27 PM Document presentation format:

Title: PowerPoint Author: Veriton Last modified by: Created Date: 8/9/2002 1:34:27 PM Document presentation format:

| PowerPoint PPT presentation | free to download

Towards Cracking the Code of Chromatin and Transcriptional Regulation PowerPoint PPT Presentation

Towards Cracking the Code of Chromatin and Transcriptional Regulation - CTAACCTGGCTACAGAATCATAAGTTGAATTCGACAGGTTATCAGCAACAACACAGTCATATCCATTCTCAATTAGCTCTACCACAGTGTGTGAACCAATGTATCCAGCACCACCTGTAACCAAAACAATTTTAGAAGTACTTTCACTTTGTAACTGAGCTGTCAT ...

CTAACCTGGCTACAGAATCATAAGTTGAATTCGACAGGTTATCAGCAACAACACAGTCATATCCATTCTCAATTAGCTCTACCACAGTGTGTGAACCAATGTATCCAGCACCACCTGTAACCAAAACAATTTTAGAAGTACTTTCACTTTGTAACTGAGCTGTCAT ...

| PowerPoint PPT presentation | free to download

Model-based clustering and validation techniques for gene expression data PowerPoint PPT Presentation

Model-based clustering and validation techniques for gene expression data - Department of Microbiology. University of Washington, Seattle WA. 8/27/09 ... Validating clustering results on microarray data. Model-based clustering using ...

Department of Microbiology. University of Washington, Seattle WA. 8/27/09 ... Validating clustering results on microarray data. Model-based clustering using ...

| PowerPoint PPT presentation | free to download

Youngstowns North Side Weed PowerPoint PPT Presentation

Youngstowns North Side Weed - Youngstown's North Side Weed & Seed Target Area. Weed & Seed is a strategy that aims to prevent and control violent crime, drug ...

Youngstown's North Side Weed & Seed Target Area. Weed & Seed is a strategy that aims to prevent and control violent crime, drug ...

| PowerPoint PPT presentation | free to view

Computational Discovery of Gene Modules and Regulatory Networks PowerPoint PPT Presentation

Computational Discovery of Gene Modules and Regulatory Networks - Computational Discovery of Gene Modules and Regulatory Networks Georg Gerber MIT Department of EECS and MIT/Harvard Health Sciences and Technology

Computational Discovery of Gene Modules and Regulatory Networks Georg Gerber MIT Department of EECS and MIT/Harvard Health Sciences and Technology

| PowerPoint PPT presentation | free to download

PCR ???? - Vector NTI Suit 5.5 Gene Construction Kit 2.0 Winplas 2.6 OLIGO 5.0 PCR Atheprot 5.0 ...

Vector NTI Suit 5.5 Gene Construction Kit 2.0 Winplas 2.6 OLIGO 5.0 PCR Atheprot 5.0 ...

| PowerPoint PPT presentation | free to view

Costi Sifri and PowerPoint PPT Presentation

Costi Sifri and - Title: Developing a Simple Pathogenicity Model System for Candida Author: Default Last modified by: Gang Wu Created Date: 3/20/2003 11:50:54 PM Document presentation ...

Title: Developing a Simple Pathogenicity Model System for Candida Author: Default Last modified by: Gang Wu Created Date: 3/20/2003 11:50:54 PM Document presentation ...

| PowerPoint PPT presentation | free to view

EUROPEAN CONGRESS OF CHEMICAL ENGINEERING PowerPoint PPT Presentation

EUROPEAN CONGRESS OF CHEMICAL ENGINEERING - ... formerly known as Candida, ... Figure 5: Effect of chemical compounds on activity of lipase extract produced by Y. lipolytica and type B from C. antarctica.

... formerly known as Candida, ... Figure 5: Effect of chemical compounds on activity of lipase extract produced by Y. lipolytica and type B from C. antarctica.

| PowerPoint PPT presentation | free to download

Computational Discovery of Gene Modules and Regulatory Networks - 28 genes were selected by the GRAM algorithm; all are involved in respiration. ... Respiration. Hap4. Activator, required for pheromone response 0.64 ...

28 genes were selected by the GRAM algorithm; all are involved in respiration. ... Respiration. Hap4. Activator, required for pheromone response 0.64 ...

| PowerPoint PPT presentation | free to download

????????? ???????? - . 4 , 2 , ( )

. 4 , 2 , ( )

| PowerPoint PPT presentation | free to download

2 Dimensional Gel Electrophoresis PowerPoint PPT Presentation

2 Dimensional Gel Electrophoresis - Title: Author: Dil Last modified by: Dil Created Date: 6/5/2004 1:53:42 PM Document presentation format:

Title: Author: Dil Last modified by: Dil Created Date: 6/5/2004 1:53:42 PM Document presentation format:

| PowerPoint PPT presentation | free to view

Evidence for dynamically organized modularity in the yeast protein-protein interaction network - Evidence for dynamically organized modularity in the yeast protein-protein interaction network

Evidence for dynamically organized modularity in the yeast protein-protein interaction network

| PowerPoint PPT presentation | free to download

? ? ? ? ? Bioinformatics PowerPoint PPT Presentation

? ? ? ? ? Bioinformatics - Bioinformatics Bioscau@21cn.com yahoo.com.cn ...

Bioinformatics Bioscau@21cn.com yahoo.com.cn ...

| PowerPoint PPT presentation | free to view

Defining the Fusarium/host interaction through genomics and proteomics - Defining the Fusarium/host interaction through genomics and proteomics

Defining the Fusarium/host interaction through genomics and proteomics

| PowerPoint PPT presentation | free to download

Yeast Genetics Lab. PowerPoint PPT Presentation

Yeast Genetics Lab. - Yeast Genetics Lab. Yeast two-hybrid system Yeast genetic analysis - tetrad dissection

Yeast Genetics Lab. Yeast two-hybrid system Yeast genetic analysis - tetrad dissection

| PowerPoint PPT presentation | free to view

Yale Fleet Safety Programs PowerPoint PPT Presentation

Yale Fleet Safety Programs - Title: Yale FBO Communications Author: Patrick J. Lynch Last modified by: ITS Document presentation format: On-screen Show (4:3) Company: Yale University

Title: Yale FBO Communications Author: Patrick J. Lynch Last modified by: ITS Document presentation format: On-screen Show (4:3) Company: Yale University

| PowerPoint PPT presentation | free to view

Protein Complex and Protein-protein Interaction PowerPoint PPT Presentation

Protein Complex and Protein-protein Interaction - ... fluorescence resonance energy transfer When will FRET occur ... normalized fluorescence ratio for cells with added IL-1a or IL-1ra calculated from data in A ...

... fluorescence resonance energy transfer When will FRET occur ... normalized fluorescence ratio for cells with added IL-1a or IL-1ra calculated from data in A ...

| PowerPoint PPT presentation | free to download

Development of Stable Flocculent Saccharomyces cerevisiae Strain for Continuous Aspergillus niger Ga PowerPoint PPT Presentation

Development of Stable Flocculent Saccharomyces cerevisiae Strain for Continuous Aspergillus niger Ga - Development of Stable Flocculent Saccharomyces cerevisiae Strain for ... Carla Oliveira, Jos A. Teixeira, Nelson Lima, Nancy A. Da Silva, and Luc lia Domingues ...

Development of Stable Flocculent Saccharomyces cerevisiae Strain for ... Carla Oliveira, Jos A. Teixeira, Nelson Lima, Nancy A. Da Silva, and Luc lia Domingues ...

| PowerPoint PPT presentation | free to view

Biyoinformatik PowerPoint PPT Presentation

Biyoinformatik - Biyoinformatik zg r ak r Bilgisayarlar n molek ler biyolojide kullan m Molek llerin boyutlu grafik temsili Molek ler dizilimler boyutlu yap ...

Biyoinformatik zg r ak r Bilgisayarlar n molek ler biyolojide kullan m Molek llerin boyutlu grafik temsili Molek ler dizilimler boyutlu yap ...

| PowerPoint PPT presentation | free to download

Using Weakly Labeled Data to Learn Models for Extracting Information from Biomedical Text PowerPoint PPT Presentation

Using Weakly Labeled Data to Learn Models for Extracting Information from Biomedical Text - Using Weakly Labeled Data to Learn Models for Extracting Information ... DAG kinase zeta. DAMOX. DASOX. DAT. DB83 protein. PubMed abstract. SwissProt dictionary ...

Using Weakly Labeled Data to Learn Models for Extracting Information ... DAG kinase zeta. DAMOX. DASOX. DAT. DB83 protein. PubMed abstract. SwissProt dictionary ...

| PowerPoint PPT presentation | free to view

Using Bayesian Networks to Analyze Expression Data PowerPoint PPT Presentation

Using Bayesian Networks to Analyze Expression Data - Title: 1 Document presentation format: On-screen Show Other titles: Arial Times New Roman Wingdings Bitstream Charter SimSun Default Design ...

Title: 1 Document presentation format: On-screen Show Other titles: Arial Times New Roman Wingdings Bitstream Charter SimSun Default Design ...

| PowerPoint PPT presentation | free to download

Functional annotation and network reconstruction through cross-platform integration of microarray data PowerPoint PPT Presentation

Functional annotation and network reconstruction through cross-platform integration of microarray data - Functional annotation and network reconstruction through cross-platform integration of microarray data X. J. Zhou et al. 2005 Challenges in microarray data analysis ...

Functional annotation and network reconstruction through cross-platform integration of microarray data X. J. Zhou et al. 2005 Challenges in microarray data analysis ...

| PowerPoint PPT presentation | free to download

Precision and functional specificity in mRNA decay PowerPoint PPT Presentation

Precision and functional specificity in mRNA decay - Saccharomyces cerevisiae strain Y262 (MATa ura3-52 his4-939am rpb1-1) ... Determination of mRNA Decay by Transcriptional Shut ... of Poly(A) Shortening Rates ...

Saccharomyces cerevisiae strain Y262 (MATa ura3-52 his4-939am rpb1-1) ... Determination of mRNA Decay by Transcriptional Shut ... of Poly(A) Shortening Rates ...

| PowerPoint PPT presentation | free to view

Core Structure PowerPoint PPT Presentation

Core Structure - Locality Admin Manager Prescribing Advisor. Sure Start - Aylesbury ... Responsible for. monitoring SLAs for:- HIV/AIDs. Refugees and. Homeless people. Podiatry ...

Locality Admin Manager Prescribing Advisor. Sure Start - Aylesbury ... Responsible for. monitoring SLAs for:- HIV/AIDs. Refugees and. Homeless people. Podiatry ...

| PowerPoint PPT presentation | free to view

Network Biology: understanding the cells functional organization - Orthology. Paralogy. 3. Graph Terminology. Node. Edge. Directed/Undirected. Degree ... The color of a node indicates the phenotypic effect of removing the ...

Orthology. Paralogy. 3. Graph Terminology. Node. Edge. Directed/Undirected. Degree ... The color of a node indicates the phenotypic effect of removing the ...

| PowerPoint PPT presentation | free to view

Taller de Bioinform PowerPoint PPT Presentation

Taller de Bioinform - Taller de Bioinform tica 16-19 de Octubre, Santiago, Chile Universidad de Chile Pontificia Universidad Cat lica de Chile CONICYT INSERM (Francia)

Taller de Bioinform tica 16-19 de Octubre, Santiago, Chile Universidad de Chile Pontificia Universidad Cat lica de Chile CONICYT INSERM (Francia)

| PowerPoint PPT presentation | free to download

PERKEMBANGAN BUMN PowerPoint PPT Presentation

PERKEMBANGAN BUMN - PERKEMBANGAN BUMN UU. No. 19/2003 ttg BUMN (ps. 1) Perkembangan BUMN 1. Generasi Pertama (1945-1959) Pada periode sebelum kemerdekaan, Pemerintah Hindia Belanda ...

PERKEMBANGAN BUMN UU. No. 19/2003 ttg BUMN (ps. 1) Perkembangan BUMN 1. Generasi Pertama (1945-1959) Pada periode sebelum kemerdekaan, Pemerintah Hindia Belanda ...

| PowerPoint PPT presentation | free to download

HughesBoone Journal Club PowerPoint PPT Presentation

HughesBoone Journal Club - Friedman et al, Hartemink et al (2001, 2002) ... Problem: Putative regulators are motifs, not TFs. Difficult to connect the clusters together. ...

Friedman et al, Hartemink et al (2001, 2002) ... Problem: Putative regulators are motifs, not TFs. Difficult to connect the clusters together. ...

| PowerPoint PPT presentation | free to view

The science of malting, brewing, and fermenting beer PowerPoint PPT Presentation

The science of malting, brewing, and fermenting beer - ... (DIMS, GC-TOF-MS) Joubert et al. (2001) Lager brewer s yeast ... MALDI MS and MS/MS) Kobi et ... (pmf). Bacteria have evolved a number of ways to ...

... (DIMS, GC-TOF-MS) Joubert et al. (2001) Lager brewer s yeast ... MALDI MS and MS/MS) Kobi et ... (pmf). Bacteria have evolved a number of ways to ...

| PowerPoint PPT presentation | free to download

ProteinProtein Interaction Networks PowerPoint PPT Presentation

ProteinProtein Interaction Networks - From Greek 'proteios' meaning 'of first importance' ... Protein-Protein Interaction networks. Unraveling the biochemistry of cells: ...

From Greek 'proteios' meaning 'of first importance' ... Protein-Protein Interaction networks. Unraveling the biochemistry of cells: ...

| PowerPoint PPT presentation | free to view

Bioinformatique:%20Projets%20g PowerPoint PPT Presentation

Bioinformatique:%20Projets%20g - Identify genes and other functional elements (regulatory ... Caenorhabditis elegans (nematode) Lycopersicon esculentum (tomato) Danio rerio (zebrafish) ...

Identify genes and other functional elements (regulatory ... Caenorhabditis elegans (nematode) Lycopersicon esculentum (tomato) Danio rerio (zebrafish) ...

| PowerPoint PPT presentation | free to download

Automated Hierarchical Density Shaving: A robust, automated clustering and visualization framework PowerPoint PPT Presentation

Automated Hierarchical Density Shaving: A robust, automated clustering and visualization framework - Density Shaving (DS) and Auto-HDS framework. Can show there is a strong connection between above algorithms. ... implementation of Auto-HDS using streaming ...

Density Shaving (DS) and Auto-HDS framework. Can show there is a strong connection between above algorithms. ... implementation of Auto-HDS using streaming ...

| PowerPoint PPT presentation | free to view

No name - P(k) = ??????????? ????, ??? ? ???????? ?????? ??????? ????? k ????? ... Random and scale-free P(k) (linear and log scales) ??????-????? ??????-??????? ...

P(k) = ??????????? ????, ??? ? ???????? ?????? ??????? ????? k ????? ... Random and scale-free P(k) (linear and log scales) ??????-????? ??????-??????? ...

| PowerPoint PPT presentation | free to download

Biological Networks PowerPoint PPT Presentation

Biological Networks - Biological Networks Graph Theory and Matrix Theory Ka-Lok Ng Department of Bioinformatics Asia University Content Topological Statistics of the protein ...

Biological Networks Graph Theory and Matrix Theory Ka-Lok Ng Department of Bioinformatics Asia University Content Topological Statistics of the protein ...

| PowerPoint PPT presentation | free to view

Information Management for Genome Level Bioinformatics PowerPoint PPT Presentation

Information Management for Genome Level Bioinformatics - Title: Incremental Maintenance of Materialized OQL Views Author: Norman Paton Last modified by: norm Created Date: 11/4/2000 11:38:08 AM Document presentation format

Title: Incremental Maintenance of Materialized OQL Views Author: Norman Paton Last modified by: norm Created Date: 11/4/2000 11:38:08 AM Document presentation format

| PowerPoint PPT presentation | free to view

Proteomics - Proteomics an emerging scientific discipline encompassing any ... Proteome analysis is conceptually attractive because of ... Experiment synopsis. Pulse ...

Proteomics an emerging scientific discipline encompassing any ... Proteome analysis is conceptually attractive because of ... Experiment synopsis. Pulse ...

| PowerPoint PPT presentation | free to view

Comparative genome analysis - Comparative genome analysis

Comparative genome analysis

| PowerPoint PPT presentation | free to view

Bienvenue - 'Le travail termin , le r sultat est apparu au milieu de la nuit, sous les n ons du centre informatique de ... AATDB, AceDb, ACUTS, ADB, AFDB, AGIS, AMSdb, ARR, AsDb, BBDB, BCGD, ...

'Le travail termin , le r sultat est apparu au milieu de la nuit, sous les n ons du centre informatique de ... AATDB, AceDb, ACUTS, ADB, AFDB, AGIS, AMSdb, ARR, AsDb, BBDB, BCGD, ...

| PowerPoint PPT presentation | free to view

How to Give an Effective Talk: Basic Concepts and Mechanics PowerPoint PPT Presentation

How to Give an Effective Talk: Basic Concepts and Mechanics - Department of Molecular Genetics. Ohio State University, Columbus, Ohio. It's All About ... by Neil Sedaka; also by The Carpenters, The Partridge Family ...

Department of Molecular Genetics. Ohio State University, Columbus, Ohio. It's All About ... by Neil Sedaka; also by The Carpenters, The Partridge Family ...

| PowerPoint PPT presentation | free to view

Cover - Cover

Cover

| PowerPoint PPT presentation | free to download

Formation of a Consortium for Teaching Genomics: Genome Consortium for Active Teaching GCAT A. Malco PowerPoint PPT Presentation

Formation of a Consortium for Teaching Genomics: Genome Consortium for Active Teaching GCAT A. Malco - Using DNA Microarrays from Multiple Species: Comparisons for ... Saint Joseph, Missouri. State-supported PUI ~5200 students. 200 faculty. Biology Department ...

Using DNA Microarrays from Multiple Species: Comparisons for ... Saint Joseph, Missouri. State-supported PUI ~5200 students. 200 faculty. Biology Department ...

| PowerPoint PPT presentation | free to download

YEAST TWOHYBRID SYSTEM detection of proteinprotein interactions PowerPoint PPT Presentation

YEAST TWOHYBRID SYSTEM detection of proteinprotein interactions - many eukaryotic transcription activators have at least two distinct functional ... mild elution using a sitespecific protease, ...

many eukaryotic transcription activators have at least two distinct functional ... mild elution using a sitespecific protease, ...

| PowerPoint PPT presentation | free to view

Protein-protein interactions PowerPoint PPT Presentation

Protein-protein interactions - Does not rely on DIRECT SEQUENCE HOMOLOGY ... 2 proteins are neighbors on the chromosome, the proteins tend to be functionally ...

Does not rely on DIRECT SEQUENCE HOMOLOGY ... 2 proteins are neighbors on the chromosome, the proteins tend to be functionally ...

| PowerPoint PPT presentation | free to download

Module Networks PowerPoint PPT Presentation

Module Networks - Lines represent 500 bp of genomic sequence located upstream to the start codon ... stock variable, instance trading day. ... Stock Market Data ...

Lines represent 500 bp of genomic sequence located upstream to the start codon ... stock variable, instance trading day. ... Stock Market Data ...

| PowerPoint PPT presentation | free to download

An introduction to biological databases PowerPoint PPT Presentation

An introduction to biological databases - biological databases Database or databank ? At the beginning, subtle distinctions were done between databases and databanks (in UK, but not in the USA), such as ...

biological databases Database or databank ? At the beginning, subtle distinctions were done between databases and databanks (in UK, but not in the USA), such as ...

| PowerPoint PPT presentation | free to download

Cover - Cover

Cover

| PowerPoint PPT presentation | free to download

Bioinformatic analysis of protein complexes PowerPoint PPT Presentation

Bioinformatic analysis of protein complexes - Comparing protein complexes and interacting proteins ... Ribosomal biogenesis. From Schafer et al, EMBO Journal (2003) Clustering of proteins ...

Comparing protein complexes and interacting proteins ... Ribosomal biogenesis. From Schafer et al, EMBO Journal (2003) Clustering of proteins ...

| PowerPoint PPT presentation | free to view

Winston Group Meeting - Winston Group Meeting

Winston Group Meeting

| PowerPoint PPT presentation | free to download

Cover - Yuma Regional Communications System. ASTRO XTS 2500 Model II. 2. Your Radio. Side Buttons ... grille area. The red light-emitting diode (LED) on top of the ...

Yuma Regional Communications System. ASTRO XTS 2500 Model II. 2. Your Radio. Side Buttons ... grille area. The red light-emitting diode (LED) on top of the ...

| PowerPoint PPT presentation | free to view

Biochemical characterization of a dipeptidylpeptidase from Scedosporium apiospermum and its encoding PowerPoint PPT Presentation

Biochemical characterization of a dipeptidylpeptidase from Scedosporium apiospermum and its encoding - Only a 33 kDa serine protease which has been purified and characterized ... Study of the expression of DPP V on strains from different origins (environment, ...

Only a 33 kDa serine protease which has been purified and characterized ... Study of the expression of DPP V on strains from different origins (environment, ...

| PowerPoint PPT presentation | free to view

Transcriptional Regulation PowerPoint PPT Presentation

Transcriptional Regulation - ???? ?????? ???? ????? ????, ????? Gal4 ?? ???? in vivo. ????? ???? ???? ???? ??????. ... ?? ???? ????? ???? ??????? ?? ?????????? ????? in vivo. ??? ???? ? ...

???? ?????? ???? ????? ????, ????? Gal4 ?? ???? in vivo. ????? ???? ???? ???? ??????. ... ?? ???? ????? ???? ??????? ?? ?????????? ????? in vivo. ??? ???? ? ...

| PowerPoint PPT presentation | free to view

Ypd PowerPoint PPT Presentations